> >>FLJ45537-FLJ45537 protein Gene
FLJ45537-FLJ45537 protein Gene View larger

FLJ45537-FLJ45537 protein Gene

PTXBC132741

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FLJ45537-FLJ45537 protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ45537-FLJ45537 protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC132741
Product type: DNA & cDNA
Ncbi symbol: FLJ45537
Origin species: Human
Product name: FLJ45537-FLJ45537 protein Gene
Size: 2ug
Accessions: BC132741
Gene id: 401535
Gene description: FLJ45537 protein
Synonyms: uncharacterized protein C9orf170; chromosome 9 open reading frame 170
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggagcaggcgcggcctcggcgtcagcagagctcccctgcatctcctcctgggggtgtgggggccgagtgggagaactggcggacagaggaaaggggcctcgctcgcaaggcccgggcggggaggcctggcctcctgctcagtcggtgcaaatggaaaaagagacgttctgtttctccggaaaaccctgactaatacagtagaggatatccagattgacaacttcaggagaaagtctgatttaggagtcggaagcccagattggaaaaacctcttgatagatgtcactcgggaagaccatgaaaacagccaaaataattcaaagagaagatgcaaagtgaactgtgaaacagaccaaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - resistin like beta
- crystallin, gamma A
- interferon, alpha 6
- chymase 1, mast cell

Reviews

Buy FLJ45537-FLJ45537 protein Gene now

Add to cart