TNFRSF13B-tumor necrosis factor receptor superfamily, member 13B Gene View larger

TNFRSF13B-tumor necrosis factor receptor superfamily, member 13B Gene

PTXBC109392

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFRSF13B-tumor necrosis factor receptor superfamily, member 13B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNFRSF13B-tumor necrosis factor receptor superfamily, member 13B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC109392
Product type: DNA & cDNA
Ncbi symbol: TNFRSF13B
Origin species: Human
Product name: TNFRSF13B-tumor necrosis factor receptor superfamily, member 13B Gene
Size: 2ug
Accessions: BC109392
Gene id: 23495
Gene description: tumor necrosis factor receptor superfamily, member 13B
Synonyms: CD267; CVID; CVID2; IGAD2; RYZN; TNFRSF14B; tumor necrosis factor receptor superfamily member 13B; transmembrane activator and CAML interactor; tumor necrosis factor receptor 13B; TNF receptor superfamily member 13B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtggcctgggccggagcaggcgaggtggccggagccgtgtggaccaggaggagcgctggtcactcagctgccgcaaggagcaaggcaagttctatgaccatctcctgagggactgcatcagctgtgcctccatctgtggacagcaccctaagcaatgtgcatacttctgtgagaacaagctcaggagcccagtgaaccttccaccagagctcaggagacagcggagtggagaagttgaaaacaattcagacaactcgggaaggtaccaaggattggagcacagaggctcagaagcaagtccagctctcccggggctgaagctgagtgcagatcaggtggccctggtctacagcacgctggggctctgcctgtgtgccgtcctctgctgcttcctggtggcggtggcctgcttcctcaagaagaggggggatccctgctcctgccagccccgctcaaggccccgtcaaagtccggccaagtcttcccaggatcacgcgatggaagccggcagccctgtgagcacatcccccgagccagtggagacctgcagcttctgcttccctgagtgcagggcgcccacgcaggagagcgcagtcacgcctgggacccccgaccccacttgtgctggaaggtgggggtgccacaccaggaccacagtcctgcagccttgcccacacatcccagacagtggccttggcattgtgtgtgtgcctgcccaggaggggggcccaggtgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2
- leucine-rich repeat-containing G protein-coupled receptor 5
- roundabout, axon guidance receptor, homolog 1 (Drosophila)
- nuclear factor of activated T-cells 5, tonicity-responsive

Reviews

Buy TNFRSF13B-tumor necrosis factor receptor superfamily, member 13B Gene now

Add to cart