Cart 2 Product Products 856,04 € (empty)
-
-
1 x Uromodulin744,00 €
No products
To be determined Shipping
856,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 856,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 856,04 €
View larger 
Data sheet of KCNK7-potassium channel, subfamily K, member 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNK7-potassium channel, subfamily K, member 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103809 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNK7 |
| Origin species: | Human |
| Product name: | KCNK7-potassium channel, subfamily K, member 7 Gene |
| Size: | 2ug |
| Accessions: | BC103809 |
| Gene id: | 10089 |
| Gene description: | potassium channel, subfamily K, member 7 |
| Synonyms: | K2p7.1; TWIK3; potassium channel subfamily K member 7; potassium channel, subfamily K, member 7; potassium channel, two pore domain subfamily K, member 7; two pore domain K+ channel; potassium two pore domain channel subfamily K member 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggggtctaaggccctggtcccgatacgggctcctggttgtggcccacttgctggccctggggcttggggctgtggtgttccaggccctggaggggcctcctgcatgcaggcttcaggctgagctcagggcagagctggcagccttccaggcagagcatagggcctgcctgccacccggagctctggaagagctgctgggcactgccctggccacccaggcccatggggtctccaccctgggcaacagctcagagggcaggacctgggaccttccctcagccctgctcttcgctgccagcatcctcaccaccacaggttatggccacatggccccactatcgccaggcggaaaggccttctgcatggtctatgcagccctggggctgccagcctccttagctctcgtggccaccctgcgccattgcctgctgcctgtgctcagccgcccacgtgcctgggtagcggtccactggcagctgtcaccggccagggctgcgctgctgcaggcagttgcactgggactgctggtggccagcagctttgtgctgctgccagcgctggtgctgtggggccttcagggcgactgcagcctgctgggggccgtctacttctgcttcagctcgctcagcaccattggcctggaggacttgctgcccggccgcggccgcagcctgcaccccgtgatttaccacctgggccagctcgcacttcttggtggagggacctcactccagggcacggcgtgggaggggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - prostate androgen-regulated transcript 1 - ATPase family, AAA domain containing 3C - gene differentially expressed in prostate - ribosomal protein L23a pseudogene 13 |