Cart 10 Product Products 1 886,97 € (empty)
-
-
1 x VILIP-1644,00 € -
-
1 x CCNH-cycli...121,50 € -
-
1 x IFIT3-inte...121,50 € -
1 x APLNR-apel...121,50 € -
1 x IFIT3-inte...121,50 € -
1 x GGPS1-gera...121,50 € -
1 x HCP5-HLA...113,40 €
No products
To be determined Shipping
1 886,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 886,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 886,97 €
View larger 
CYP2F1-cytochrome P450, family 2, subfamily F, polypeptide 1 Gene
PTXBC109056
New product
Data sheet of CYP2F1-cytochrome P450, family 2, subfamily F, polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYP2F1-cytochrome P450, family 2, subfamily F, polypeptide 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109056 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYP2F1 |
| Origin species: | Human |
| Product name: | CYP2F1-cytochrome P450, family 2, subfamily F, polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC109056 |
| Gene id: | 1572 |
| Gene description: | cytochrome P450, family 2, subfamily F, polypeptide 1 |
| Synonyms: | C2F1; CYP2F; CYPIIF1; cytochrome P450 2F1; cytochrome P450, family 2, subfamily F, polypeptide 1; cytochrome P450, subfamily IIF, polypeptide 1; flavoprotein-linked monooxygenase; microsomal monooxygenase; xenobiotic monooxygenase; cytochrome P450 family 2 subfamily F member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacagcataagcacagccatcttactcctgctcctggctctcgtctgtctgctcctgaccctaagctcaagagataagggaaagctgcctccgggacccagacccctctcaatcctgggaaacctgctgctgctttgctcccaagacatgctgacttctctcactaagctgagcaaggagtatggctccatgtacacagtgcacctgggacccaggcgggtggtggtcctcagcgggtaccaagctgtgaaggaggccctggtggaccagggagaggagtttagtggccgcggtgactaccctgcctttttcaactttaccaagggcaatggcatcgccttctccagtggggatcgatggaaggtcctgagacagttctctatccagattctacggaatttcgggatggggaagagaagcattgaggagcgaatcctagaggagggcagcttcctgctggcggagctgcggaaaactgaaggcgagccctttgaccccacgtttgtgctgagtcgctcagtgtccaacattatctgttccgtgctcttcggcagccgcttcgactatgatgatgagcgtctgctcaccattatccgccttatcaatgacaacttccaaatcatgagcagcccctggggcgagttgtacgacatcttcccgagcctcctggactgggtgcctgggccgcaccaacgcatcttccagaacttcaagtgcctgagagacctcatcgcccacagcgtccacgaccaccaggcctcgctagaccccagatctccccgggacttcatccagtgcttcctcaccaagatggcagaggagaaggaggacccactgagccacttccacatggataccctgctgatgaccacacataacctgctctttggcggcaccaagacgcccgcgtgcaggaggagatcgacctcgtggtgggacgcgcgcggctgccggcgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - germ and embryonic stem cell enriched protein STELLA - proteasome (prosome, macropain) subunit, alpha type, 5 - killer cell lectin-like receptor subfamily B, member 1 - triggering receptor expressed on myeloid cells-like 2 |