Cart 9 Product Products 1 021,13 € (empty)
-
1 x SORD-sorbi...121,50 € -
-
-
1 x GTPBP3-GTP...121,50 € -
1 x SRD5A3-ste...121,50 € -
-
1 x LACTB2-lac...121,50 € -
-
1 x CAMK4-calc...121,50 €
No products
To be determined Shipping
1 021,13 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 021,13 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 021,13 €
Data sheet of SNAI3-snail homolog 3 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNAI3-snail homolog 3 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC107058 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNAI3 |
| Origin species: | Human |
| Product name: | SNAI3-snail homolog 3 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC107058 |
| Gene id: | 333929 |
| Gene description: | snail homolog 3 (Drosophila) |
| Synonyms: | zinc finger protein SNAI3; SMUC; SNAIL3; ZNF293; Zfp293; protein snail homolog 3; snail family zinc finger 3; snail homolog 3; zinc finger protein 293; snail family transcriptional repressor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgcgctccttcctggtgaaaacgcactccagccacagggtccccaactaccggcggctggagacgcagagagaaatcaatggtgcctgctctgcctgtggggggctggtggtgcccctcctcccccgagacaaggaggccccttctgtgcccggtgaccttccccagccctgggaccgctcctcggccgtcgcctgcatctccctgcccctcctgccacggatcgaggaagctctgggggcctctgggctggacgccttggaagtcagcgaggtcgaccctcgggccagccgggccgccattgtacccctcaaagacagcctgaaccacctcaacctgcccccactgctggtgctgcccacacggtggtccccgaccttgggcccagaccggcacggggctccggaaaaactgcttggggctgagcggatgccccgagccccgggcggctttgagtgcttccactgccacaaaccctaccacacgctggccgggctggccaggcaccggcagctgcactgccacctgcaggtggggcgtgtcttcacctgcaagtactgcgacaaggagtacaccagcctgggtgccctcaagatgcacatccgcactcacacgctgccctgcacctgcaagatctgtggcaaggccttctccaggccctggttactgcagggccatgtccgcacccacacaggggagaagccctatgcctgctcgcactgcagcagggcctttgccgaccgctccaaccttcgggcccatctgcaaacgcactcagacgccaagaagtaccggtgccggcgctgcaccaagaccttctcccgcatgtccctcctggcgcggcatgaggagtctggctgctgcccgggcccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ornithine carbamoyltransferase - P antigen family, member 2B - thymosin-like 2 (pseudogene) - H2B histone family, member S |