Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MAGEC3-melanoma antigen family C, 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAGEC3-melanoma antigen family C, 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC103893 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAGEC3 |
| Origin species: | Human |
| Product name: | MAGEC3-melanoma antigen family C, 3 Gene |
| Size: | 2ug |
| Accessions: | BC103893 |
| Gene id: | 139081 |
| Gene description: | melanoma antigen family C, 3 |
| Synonyms: | CT7.2; HCA2; MAGE-C3; MAGEC4; melanoma-associated antigen C3; MAGE family testis and tumor-specific protein; MAGE-C3 antigen; cancer/testis antigen 7.2; cancer/testis antigen family 7, member 2; hepatocellular carcinoma-associated antigen 2; hepatocellular carcinoma-associated protein HCA2; melanoma antigen family C, 3; melanoma antigen family C3; MAGE family member C3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctctctttccaaaccttccacgcctcagctttgaggaagacttccagaacccgagtgtgacagaggacttggtagatgcacaggattccatagatgaggaggaggaggatgcctcctccacttcctcttcctctttccactttttattcccctcctcctcttccttgtcctcatcctcacccttgtcctcacccttaccctctactctcattctgggtgttccagaagatgaggatatgcctgctgctgggatgccacctcttccccagagtcctcctgagattcctccccagggtcctcccaagatctctccccagggtcctccgcagagtcctccccagagtcctctagactcctgctcatcccctcttttgtggacccgattggatgaggagtccagcagtgaagaggaggatacagctacttggcatgccttgccagaaagtgaatccttgcccaggtatgccctggatgaaaaggtggctgagttggtgcagtttcttctcctcaaatatcaaacaaaagagcctgtcacaaaggcagagatgctgacgactgtcatcaagaagtataaggactattttcccatgatcttcgggaaagcccatgagttcatagagctaatttttggcattgccctgactgatatggaccccgacaaccactcctatttctttgaagacacattagacctcacctatgagggaagcctgattgatgaccagggcatgcccaagaactgtctcctgattcttattctcagtatgatcttcataaagggcagctgtgtccccgaggaggtcatctgggaagtgttgagtgcaataggggtgtgtgctgggagggagcactttatatatggggatcccagaaagctgctcactatacattgggtgcagagaaagtacctggagtaccgggaggtgcccaacagtgctcctccacgttatgaatttttgtggggtccaagagcccattcagaggccagcaagagaagtcttagagtttttatccaagctatccagtatcatccctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polo-like kinase 5 pseudogene - Nanog homeobox pseudogene 8 - hypothetical LOC54744 - chemokine (C-C motif) ligand 4 |