Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RGL4-ral guanine nucleotide dissociation stimulator-like 4 Gene
PTXBC101108
New product
Data sheet of RGL4-ral guanine nucleotide dissociation stimulator-like 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RGL4-ral guanine nucleotide dissociation stimulator-like 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101108 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RGL4 |
| Origin species: | Human |
| Product name: | RGL4-ral guanine nucleotide dissociation stimulator-like 4 Gene |
| Size: | 2ug |
| Accessions: | BC101108 |
| Gene id: | 266747 |
| Gene description: | ral guanine nucleotide dissociation stimulator-like 4 |
| Synonyms: | Rgr; ral-GDS-related protein; Ral-GDS related protein Rgr; RalGDS related oncogene; ralGDS-like 4; ral guanine nucleotide dissociation stimulator like 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggccctggagccagcaccaccactgctggcggacctggggcctgctctggagccagagtcacctgcagccctgggtccaccaggatatctacattcagcaccagggccagcaccagcaccaggggaagggccccctccagggacagtgctggagccacagtcagccccagagtcctcctgtccctgtcgtgggtctgtaaagaaccaacccagtgaggagctgcctgacatgacgaccttccctcccaggctgctggcagagcagctgaccctcatggatgcggagctgttcaagaaggtggtgctctacgaatgcttgggctgcatctggggccaaggacatctgaaggggaatgagcacatggcacccacagttcgtgccaccatcgcacacttcaacaggctcaccaactgcatcaccacctcctgcctcggggaccacagcatgagggcccgggacagggccagggtggtggagcactggatcaaggtggccagggagtgcctaagcctcaacaacttctcctcggtgcacgtcatcgtctctgctctgtgcagcaacccaataggtcagctacacaagacgtgggcaggagtgtccagcaaaagcatgaaagagctaaaagaactctgcaaaaaagacactgcagtgaagagggacctactgatcaaggcggggagctttaaggtggccacccaggagaggaacccccagagagcccagatgaggctgcggaggcagaagaagggtgtggtccccttcctgggggattttctgactgagttacagaggctggattcggccatcccggacgacctggatggcaacaccaacaagaggagcaaggaggtccgagttctgcaggaaatgcagctgctccaagtggctgccatgaattacaggcttcggcctcttgagaaatttgtcacctatttcacaagaatggagcagctcagtgacaaagagagatggggtttcacgatgatgtccaggatcgtctcaaactcctggcctcaagcaatccacccacctcagcctcccaaagtactgacgttacaggtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleotide binding protein 1 (MinD homolog, E. coli) - melanocortin 2 receptor (adrenocorticotropic hormone) - capping protein (actin filament) muscle Z-line, beta - staufen, RNA binding protein, homolog 2 (Drosophila) |