PTXBC113488
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC113488 |
Product type: | DNA & cDNA |
Ncbi symbol: | FSHB |
Origin species: | Human |
Product name: | FSHB-follicle stimulating hormone, beta polypeptide Gene |
Size: | 2ug |
Accessions: | BC113488 |
Gene id: | 2488 |
Gene description: | follicle stimulating hormone, beta polypeptide |
Synonyms: | HH24; follitropin subunit beta; FSH-B; FSH-beta; follicle stimulating hormone, beta polypeptide; follitropin, beta chain; follicle stimulating hormone beta subunit |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaagacactccagtttttcttccttttctgttgctggaaagcaatctgctgcaatagctgtgagctgaccaacatcaccattgcaatagagaaagaagaatgtcgtttctgcataagcatcaacaccacttggtgtgctggctactgctacaccagggatctggtgtataaggacccagccaggcccaaaatccagaaaacatgtaccttcaaggaactggtatacgaaacagtgagagtgcccggctgtgctcaccatgcagattccttgtatacatacccagtggccacccagtgtcactgtggcaagtgtgacagcgacagcactgattgtactgtgcgaggcctggggcccagctactgctcctttggtgaaatgaaagaataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - LIM and senescent cell antigen-like domains 3 - Rac GTPase activating protein 1 pseudogene - small nuclear ribonucleoprotein polypeptide C - family with sequence similarity 12, member A |