Cart 7 Product Products 804,71 € (empty)
-
-
1 x IL28A-inte...113,40 € -
-
1 x ORC6L-orig...113,40 € -
1 x ARMCX3-arm...121,50 € -
1 x RRP15-ribo...113,40 € -
1 x RBMS3-RNA...121,50 €
No products
To be determined Shipping
804,71 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 804,71 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 804,71 €
View larger 
OR10H3-olfactory receptor, family 10, subfamily H, member 3 Gene
PTXBC113844
New product
Data sheet of OR10H3-olfactory receptor, family 10, subfamily H, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR10H3-olfactory receptor, family 10, subfamily H, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113844 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR10H3 |
| Origin species: | Human |
| Product name: | OR10H3-olfactory receptor, family 10, subfamily H, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC113844 |
| Gene id: | 26532 |
| Gene description: | olfactory receptor, family 10, subfamily H, member 3 |
| Synonyms: | olfactory receptor 10H3; olfactory receptor OR19-24; olfactory receptor family 10 subfamily H member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctggtcagaactacagaaccatatctgaatttatcctctctggcttctcagccttcccccagcagctcctgcctgtcttgttcctgctgtacctcctgatgttcctgttcacattgcttggcaaccttcttatcatggccacagtttggattgaacgcagactccacacacccatgtacctcttcttgtgtgccctctccatctctgagattctgttcactgttgccatcacccctcgcatgctggctgatctgctcttcacccatcgttccatcacctttgtggcttgtgccattcagatgttcttctccttcatgtttggcttcactcactccttccttctcatggtcatgggctatgatcactacgtgaccatctgccacccactgcattacaacatgctaatgagtccccgtggctgtgcccatcttgtggcctggacctgggctggtggctcggtcatggggatgatggtgacaatgatggtttttcacctcactttctgtgggtctaatgtgatccaccattttctctgtcatgtgctttccctcttgaagttggcctgtgggagcaagacatcatctgtcatcatgggtgtgatgctggtgtgtgtcacagccctgataggctgtttgttcctcatcatcctctcctttgtcttcattatggctgccatcttgaggattccttctgctgagggccggcacaagactttctccacttgtgtatcccacctcactgtggtggtcatgcactatagttttgcctcccttatctacctcaaacccaagggcctccattctatgtacagtgatgccttgatggccaccacctatactgtcttcacccccttcctcagcccaatcattttcagtctaaggaacaaggagctgaagaatgccataaataaaaacttttgcagaaggttctgccctctaagctcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - basic leucine zipper transcription factor, ATF-like 3 - transcriptional adaptor 2 (ADA2 homolog, yeast)-beta - chaperonin containing TCP1, subunit 8 (theta)-like 2 - transforming, acidic coiled-coil containing protein 3 |