Cart 4 Product Products 440,46 € (empty)
-
-
-
1 x CRYGD-crys...113,40 € -
1 x COQ9-coenz...121,50 €
No products
To be determined Shipping
440,46 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 440,46 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 440,46 €
Data sheet of FZD5-frizzled homolog 5 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FZD5-frizzled homolog 5 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC114346 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FZD5 |
| Origin species: | Human |
| Product name: | FZD5-frizzled homolog 5 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC114346 |
| Gene id: | 7855 |
| Gene description: | frizzled homolog 5 (Drosophila) |
| Synonyms: | C2orf31; HFZ5; frizzled-5; Wnt receptor; frizzled 5, seven transmembrane spanning receptor; frizzled family receptor 5; fz-5; fzE5; seven-transmembrane receptor frizzled-5; frizzled class receptor 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacgcttccgctatcctgagcgccccatcatcttcctgtcagcctgctacctgtgcgtgtcgctgggcttcctggtgcgtctggtcgtgggccatgccagcgtggcctgcagccgcgagcacaaccacatccactacgagaccacgggccctgcactgtgcaccatcgtcttcctcctggtctacttcttcggcatggccagctccatctggtgggtcatcctgtcgctcacctggttcctggccgccggcatgaagtggggcaacgaggccatcgcgggctacgcgcagtacttccacctggctgcgtggctcatccccagcgtcaagtccatcacggcactggcgctgagctccgtggacggggacccagtggccggcatctgctacgtgggcaaccagaacctgaactcgctgcgcggcttcgtgctgggcccgctggtgctctacctgctggtgggcacgctcttcctgctggcgggcttcgtgtcgctcttccgcatccgcagcgtcatcaagcagggcggcaccaagacggacaagctggagaagctcatgatccgcatcggcatcttcacgctgctctacacggtccccgccagcattgtggtggcctgctacctgtacgagcagcactaccgcgagagctgggaggcggcgctcacctgcgcctgcccgggccacgacaccggccagccgcgcgccaagcccgagtactgggtgctcatgctcaagtacttcatgtgcctggtggtgggcatcacgtcgggcgtctggatctggtcgggcaagacggtggagtcgtggcggcgtttcaccagccgctgctgctgccgcccgcggcgcggccacaagagcgggggcgccatggccgcaggggactaccccgaggcgagcgccgcgctcacaggcaggaccgggccgccgggccccgccgccacctaccacaagcaggtgtccctgtcgcacgtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - small proline-rich protein 2A - glycophorin B (MNS blood group) - disrupted in renal carcinoma 1 - interferon, beta 1, fibroblast |