Cart 49 Product Products 7 307,88 € (empty)
-
1 x CTHRC1-col...113,40 € -
1 x MPV17-MpV1...113,40 € -
1 x HMGB1-high...113,40 € -
1 x MTFR1-mito...121,50 € -
1 x ARMET-argi...113,40 € -
-
-
1 x SH3BP5-SH3...121,50 € -
1 x TFF1-trefo...113,40 € -
1 x XPA-xerode...121,50 € -
1 x ETV1-ets...121,50 € -
-
1 x C11orf51-c...113,40 € -
1 x C1orf156-c...121,50 € -
1 x PACSIN2-pr...121,50 € -
1 x ASPH-aspar...113,40 € -
1 x WDR92-WD...121,50 € -
1 x TOMM40-tra...121,50 € -
1 x GAS7-growt...121,50 € -
1 x CBX6-chrom...121,50 € -
1 x ATG12-ATG1...113,40 € -
1 x TRAPPC10-t...121,50 € -
1 x G6PC2-gluc...121,50 € -
-
1 x AFAP1L1-ac...121,50 € -
1 x GATA2-GATA...121,50 € -
-
-
1 x POLD2-poly...121,50 € -
1 x WSCD2-WSC...113,40 € -
1 x SIX2-SIX...121,50 € -
1 x CACNG1-cal...113,40 € -
1 x APOL1-apol...113,40 € -
1 x CBARA1-cal...121,50 € -
1 x IGLC1-immu...113,40 € -
1 x LigaTrap...984,64 € -
1 x SEMG1-seme...121,50 € -
1 x TRPT1-tRNA...113,40 € -
1 x ANKRD54-an...121,50 € -
-
1 x Collagen...744,00 € -
1 x IL1RN-inte...113,40 € -
1 x PLTP-phosp...121,50 € -
1 x SPSB2-splA...113,40 € -
1 x XKR3-XK,...121,50 € -
1 x VCAN-versi...121,50 € -
-
1 x TTRAP-TRAF...121,50 € -
1 x RPS16-ribo...113,40 €
No products
To be determined Shipping
7 307,88 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 49 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 307,88 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 307,88 €
Data sheet of DAP3-death associated protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DAP3-death associated protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC107488 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DAP3 |
| Origin species: | Human |
| Product name: | DAP3-death associated protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC107488 |
| Gene id: | 7818 |
| Gene description: | death associated protein 3 |
| Synonyms: | DAP-3; MRP-S29; MRPS29; bMRP-10; 28S ribosomal protein S29, mitochondrial; S29mt; ionizing radiation resistance conferring protein; mitochondrial 28S ribosomal protein S29; death associated protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgctgaaaggaataacaaggcttatctctaggatccataagttggaccctgggcgttttttacacatggggacccaggctcgccaaagcattgctgctcacctagataaccaggttccagttgagagtccgagagctatttcccgcaccaatgagaatgacccggccaagcatggggatcagcacgagggtcagcactacaacatctccccccaggatttggagactgtatttccccatggccttcctcctcgctttgtgatgcaggtgaagacattcagtgaagcttgcctgatggtaaggaaaccagccctagaacttctgcattacctgaaaaacaccagttttgcttatccagctatacgatatcttctgtatggagagaagggaacaggaaaaaccctaagtctttgccatgttattcatttctgtgcaaaacaggactggctgatactacatattccagatgctcatctttgggtgaaaaattgtcgggatcttctgcagtccagctacaacaaacagcgctttgatcaacctttagaggcttcaacctggctgaagaatttcaaaactacaaatgagcgcttcctgaaccagataaaagttcaagagaagtatgtctggaataagagagaaagcactgagaaagggagtcctctgggagaagtggttgaacagggcataacacgggtgaggaacgccacagatgcagttggaattgtgctgaaagagctaaagaggcaaagttctttgggtatgtttcacctcctagtggccgtggatggaatcaatgctctttggggaagaaccactctgaaaagagaagataaaagcccgattgcccccgaggaattagcacttgttcacaacttgaggaaaatgatgaaaaatgattggcatggaggcgccattgtgtcggctttgagccagactgggtctctctttaagccccggaaagcctatctgccccaggagttgctgggaaaggaaggatttgatgccctggatccctttattcccatcctggtttccaactataacccaaaggaatttgaaagttgtattcagtattatttggaaaacaattggcttcaacatgagaaagctcctacagaagaagggaaaaaagagctgctgttcctaagtaacgcgaacccctcgctgctggagcggcactgtgcctacctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - histone cluster 1, H4h - keratin 8 pseudogene 12 - histone cluster 1, H3h - hypothetical LOC388387 |