Cart 2 Product Products 234,90 € (empty)
-
1 x TPST1-tyro...121,50 € -
1 x PHF5A-PHD...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of LASS6-LAG1 homolog, ceramide synthase 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LASS6-LAG1 homolog, ceramide synthase 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109285 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LASS6 |
| Origin species: | Human |
| Product name: | LASS6-LAG1 homolog, ceramide synthase 6 Gene |
| Size: | 2ug |
| Accessions: | BC109285 |
| Gene id: | 253782 |
| Gene description: | LAG1 homolog, ceramide synthase 6 |
| Synonyms: | LASS6; CERS5; ceramide synthase 6; LAG1 homolog, ceramide synthase 6; longevity assurance homolog 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagggatcttagcctggttctggaacgagaggttttggctcccgcacaatgtcacctgggcggacctgaagaacacggaggaggccaccttcccgcaggctgaggacctctatctcgcttttcccctggccttctgtatcttcatggtgcggctcatcttcgagagatttgtagccaaaccgtgcgccatagccctcaacattcaggccaatggaccacaaattgctccgcccaatgccattctggaaaaggtcttcactgcaattacaaagcatcctgatgaaaagagattggaaggcctctccaagcaactggactgggatgttcgaagcattcagcgctggtttcgacaaagacgcaatcaggagaagccaagcacgctgacgaggttctgtgagagcatgtggagattttcattttacctttatgtatttacctacggagtcagattcctgaaaaagaccccctggttgtggaatacgaggcattgctggtacaactacccctatcagccactcacaactgaccttcactactattacatcctggagctgtcgttttattggtctttgatgttttctcagttcactgatatcaaaagaaaggactttggcattatgttcctgcaccaccttgtatctattttcttgattaccttttcatatgtcaacaatatggcccgagtaggaacgctggtcctttgtcttcatgattcagctgatgctcttctggaggctgccaaaatggcaaattatgccaagtttcagaaaatgtgtgatctcctgtttgttatgtttgccgtggtttttatcaccacacgactgggtatatttcctctctgggtgttaaataccacattatttgaaagctgggagatcgttggaccttacccttcctggtgggtttttaacctactgctattgctagtacaagggttgaactgcttctggtcttacttgattgtgaaaatagcttgcaaagctgtttcaagaggcaaggctgggaagtggaaccctttacatgtgtccaaggatgatcgaagtgatattgagtctagctcagatgaggaggactcagaacctccgggaaagaatccccacactgcgacaaccaccaatgggaccagtggtaccaacgggtatctcctgactggctcctgctccatggatgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aldolase C, fructose-bisphosphate - torsin A interacting protein 2 - mucin 21, cell surface associated - keratin associated protein 5-6 |