Cart 15 Product Products 2 040,94 € (empty)
-
1 x NEU1-siali...121,50 € -
1 x ZBTB37-zin...121,50 € -
1 x ANKS6-anky...113,40 € -
1 x PRPS1-phos...121,50 € -
1 x CARTPT-CAR...113,40 € -
1 x GAL-galani...113,40 € -
1 x PISD-phosp...121,50 € -
1 x C19orf40-c...113,40 € -
1 x SGK493-pro...121,50 € -
1 x Phospho-HS...259,07 € -
1 x Neurexin I...259,07 € -
1 x FCGR3A-Fc...121,50 € -
1 x SNCG-synuc...113,40 € -
1 x RPL12-ribo...113,40 € -
1 x MGC52282-h...113,40 €
No products
To be determined Shipping
2 040,94 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 15 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 040,94 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 040,94 €
Data sheet of LHX5-LIM homeobox 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LHX5-LIM homeobox 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109230 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LHX5 |
| Origin species: | Human |
| Product name: | LHX5-LIM homeobox 5 Gene |
| Size: | 2ug |
| Accessions: | BC109230 |
| Gene id: | 64211 |
| Gene description: | LIM homeobox 5 |
| Synonyms: | LIM/homeobox protein Lhx5; LIM homeobox protein 5; LIM homeobox 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggtgcactgcgccggttgcgagcggcccatcctcgaccgctttctgctgaacgtgctggaccgcgcgtggcacatcaaatgtgttcagtgctgcgagtgcaaaaccaacctctcggagaagtgcttctcgcgcgagggcaagctctactgcaaaaatgactttttcaggcgctttggcacgaaatgcgccggctgcgcgcaaggcatctcacccagcgacctggtgcgcaaggcccggagcaaagtctttcacctcaactgtttcacctgcatggtgtgtaacaagcagctgtccaccggcgaggagctctacgtcatcgacgagaacaagttcgtgtgcaaagacgactacctgagctcatccagcctcaaggagggcagcctcaactcagtgtcatcctgtacggaccgcagtttgtccccggacctccaggacgcactgcaggacgaccccaaagagacggacaactcgacctcgtcggacaaggagacggccaacaacgagaacgaggagcagaactcgggcaccaagcggcgcggcccccgcaccaccatcaaggccaagcagctggagacgctcaaggctgccttcgccgccacgcccaagcccacgcgccacatccgcgagcagctggcgcaggagaccggcctcaacatgcgcgtcatccaggtgtggtttcagaaccgacggtccaaagaacgccggatgaaacagctgagcgccctaggcgcccggaggcacgccttcttccggagtccgcggcgcatgcgtccgctgggcggccgcttggacgagtctgagatgttggggtccaccccgtacacctactacggagactaccaaggcgactactacgcgccgggaagcaactacgacttcttcgcgcacggcccgccttcgcaggcgcagtccccggccgactccagcttcctggcggcctctggccccggctcgacgccgctgggagcgctggaaccgccgctcgccggcccgcacgccgcggacaaccccaggttcaccgacatgatctcgcacccggacacaccgagccccgagccaggcctgccgggcacgctgcaccccatgcccggcgaggtattcagcggcgggcccagcccgcccttcccaatgagcggcaccagcggctacagcggacccctgtcgcatcccaaccccgagctcaacgaagccgccgtgtggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LIM homeobox 6 - interleukin 13 - HLA complex P5 - CXXC finger 4 |