Cart 39 Product Products 5 893,26 € (empty)
-
-
1 x CHST12-car...121,50 € -
1 x PSG9-pregn...121,50 € -
-
1 x TAC3-tachy...113,40 € -
-
1 x IHPK2-inos...113,40 € -
1 x SCPEP1-ser...121,50 € -
1 x Peroxin 14...259,07 € -
1 x LASP1-LIM...121,50 € -
1 x HNRNPF-het...121,50 € -
1 x SLC2A1-sol...121,50 € -
-
1 x RPL37A-rib...113,40 € -
1 x TMEM182-tr...113,40 € -
1 x Fish...259,07 € -
1 x C13orf1-ch...113,40 € -
-
1 x PLSCR1-pho...121,50 € -
1 x ZBBX-zinc...121,50 € -
1 x GNAZ-guani...121,50 € -
1 x Interleukin-6469,00 € -
1 x DNAJA2-Dna...121,50 € -
-
1 x FLJ32214-h...121,50 € -
1 x ASL-argini...121,50 € -
1 x RIMKLA-rib...121,50 € -
1 x GJB1-gap...121,50 € -
1 x Phospho-NA...259,07 € -
-
1 x TM7SF2-tra...121,50 € -
1 x MRPL34-mit...113,40 € -
1 x DNAJC24-Dn...113,40 € -
-
1 x LOC554206-...113,40 € -
1 x PILRA-pair...113,40 € -
1 x CEACAM8-ca...121,50 € -
1 x RGS17-regu...113,40 € -
1 x Phospho-Ta...259,07 €
No products
To be determined Shipping
5 893,26 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 39 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 893,26 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 893,26 €
Data sheet of RNF180-ring finger protein 180 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF180-ring finger protein 180 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101277 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF180 |
| Origin species: | Human |
| Product name: | RNF180-ring finger protein 180 Gene |
| Size: | 2ug |
| Accessions: | BC101277 |
| Gene id: | 285671 |
| Gene description: | ring finger protein 180 |
| Synonyms: | E3 ubiquitin-protein ligase RNF180; RINES; ring finger protein 180 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaaagaagcaaagaattgataactaaaaatcatagtcaagaggaaacaagtattcttcgttgttggaaatgtagaaaatgtatagcaagctctggttgttttatggagtatcttgagaatcaagtgattaaggataaagatgattcagttgatgctcaaaatatttgtcatgtgtggcacatgaatgtagaagcccttccagaatggataagctgcctaatccaaaaagcccagtggacagttggaaaactgaattgtcctttctgtggggcccgtttagggggctttaattttgtcagcactccaaaatgttcctgtggccagcttgcagctgtacatctctccaagagccggactgattatcagccaacacaggcaggcagactaatgagaccatcagtgaaatacttgtcacatcctagagttcagtcaggttgtgacaaggaagctctgctgacaggtggtggctctgaaaacagaaatcacaggcttttaaacatggcccgaaataataatgaccctggaagattaacagaagcactctgcctggaggtgcgaccaacatattttgagatgaagaacgaaaaactgctgtccaaagcatcagaaccaaaataccagctttttgttccccagcttgtgactggcagatgcgctacaagagcttttcatagaaaatcacatagtttggatctgaacatcagtgagaaactgactttattacccactttatatgaaatacatagtaagactactgcctattccagactaaatgaaacacagcctattgacctttcaggcttgcctttacaatctagtaaaaatagctattcctttcagaatccatccagttttgatcctagtatgctgctgcaaagattttcagtggccccccatgagacccagacacaaagaggaggagaatttcagtgtggtctagaagctgcttcagtgtattctgaccatactaatactaacaatctgactttcctgatggacctgccctcagctggcaggagcatgccggaggcctcagaccaggaagagcacctctcccctctggacttcctgcactcagccaatttttcattgggcagcattaatcagaggcttaataagagagaaaggagcaagttgaagaatctaagaaggaaacaacgaaggcgtgaaagatggctacagaagcagggtaaatactcaggagtgggattgctggatcatatggtaagtatatatttacttatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 562 - prokineticin receptor 1 - zinc finger protein 829 - forkhead box D4-like 6 |