Cart 3 Product Products 356,40 € (empty)
-
1 x SUCLG2-suc...121,50 € -
1 x CUEDC2-CUE...113,40 € -
1 x AVL9-AVL9...121,50 €
No products
To be determined Shipping
356,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 356,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 356,40 €
View larger 
SLC39A8-solute carrier family 39 (zinc transporter), member 8 Gene
PTXBC012125
New product
Data sheet of SLC39A8-solute carrier family 39 (zinc transporter), member 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC39A8-solute carrier family 39 (zinc transporter), member 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012125 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC39A8 |
| Origin species: | Human |
| Product name: | SLC39A8-solute carrier family 39 (zinc transporter), member 8 Gene |
| Size: | 2ug |
| Accessions: | BC012125 |
| Gene id: | 64116 |
| Gene description: | solute carrier family 39 (zinc transporter), member 8 |
| Synonyms: | BIGM103; CDG2N; LZT-Hs6; PP3105; ZIP8; zinc transporter ZIP8; BCG induced integral membrane protein BIGM103; BCG-induced integral membrane protein in monocyte clone 103 protein; LIV-1 subfamily of ZIP zinc transporter 6; ZIP-8; Zrt- and Irt-like protein 8; solute carrier family 39 (metal ion transporter), member 8; solute carrier family 39 member 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccccgggtcgcgcggtggccgggctcctgttgctggcggccgccggcctcggaggagtggcggaggggccagggctagccttcagcgaggatgtgctgagcgtgttcggcgcgaatctgagcctgtcggcggcgcagctccagcacttgctggagcagatgggagccgcctcccgcgtgggcgtcccggagcctggccagctgcacttcaaccagtgtttaactgctgaagagatcttttcccttcatggcttttcaaatgctacccaaataaccagctccaaattctctgtcatctgtccagcagtcttacagcaattgaactttcacccatgtgaggatcggcccaagcacaaaacaagaccaagtcattcagaagtttggggatatggattcctgtcagtgacgattattaatctggcatctctcctcggattgattttgactccactgataaagaaatcttatttcccaaagattttgaccttttttgtggggctggctattgggactcttttttcaaatgcaattttccaacttattccagaggcatttggatttgatcccaaagtcgacagttatgttgagaaggcagttgctgtgtttggtggattttacctacttttcttttttgaaagaatgctaaagatgttattaaagacatatggtcagaatggtcatacccactttggaaatgataactttggtcctcaagaaaaaactcatcaacctaaagcattacctgccatcaatggtgtgacatgctatgcaaatcctgctgtcacagaagctaatggacatatccattttgataatgtcagtgtggtatctctacaggatggaaaaaaagagccaagttcatgtacctgtttgaaggggcccaaactgtcagaaatagggacgattgcctggatgataacgctctgcgatgccctccacaatttcatcgatggcctggcgattggggcttcctgcaccttgtctctccttcagggactcagtacttccatagcaatcctatgtgaggagtttccccacgagttaggagactttgtgatcctactcaatgcagggatgagcactcgacaagccttgctattcaacttcctttctgcatgttcctgctatgttgggctagcttttggcattttggtgggcaacaatttcgctccaaatattatatttgcacttgctggaggcatgttcctctatatttctctggcagatatgtttccagagatgaatgatatgctgagagaaaaggtaactggaagaaaaaccgatttcaccttcttcatgattcagaatgctggaatgttaactggattcacagccattctactcattaccttgtatgcaggagaaatcgaattggagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc metallopeptidase (STE24 homolog, S. cerevisiae) - asparaginyl-tRNA synthetase 2, mitochondrial (putative) - phosphatidylinositol glycan anchor biosynthesis, class A - mitogen-activated protein kinase associated protein 1 |