Cart 3 Product Products 787,55 € (empty)
-
1 x PYCR1-pyrr...113,40 € -
-
No products
To be determined Shipping
787,55 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 787,55 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 787,55 €
View larger 
Data sheet of TRNAU1AP-tRNA selenocysteine 1 associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRNAU1AP-tRNA selenocysteine 1 associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039879 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRNAU1AP |
| Origin species: | Human |
| Product name: | TRNAU1AP-tRNA selenocysteine 1 associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC039879 |
| Gene id: | 54952 |
| Gene description: | tRNA selenocysteine 1 associated protein 1 |
| Synonyms: | PRO1902; SECP43; TRSPAP1; tRNA selenocysteine 1-associated protein 1; tRNA selenocysteine associated protein (SECP43); tRNA selenocysteine-associated protein 1; tRNA selenocysteine 1 associated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtatgaattcttcgtcaaagtctacccctcctgtcggggaggcaaggtggttttggaccagacaggcgtgtctaagggttatggttttgtgaaattcacagatgaactggaacagaagcgagccctgacggagtgccagggagcagtgggactggggtctaagcctgtgcggctgagcgtggcaatccctaaagcgagccgtgtaaagccagtggaatatagtcagatgtacagttatagctacaaccagtattatcagcagtaccagaactactatgctcagtggggctatgaccagaacacaggcagctacagctacagttacccccagtatggctatacccagagcaccatgcagacatatgaagaagttggagatgatgcattggaagaccccatgccacagctggatgtgactgaggccaacaaggagttcatggaacagagtgaggagctgtatgacgctctgatggactgtcactggcagcccctggacacagtgtcttcagagatccctgccatgatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAS-like, estrogen-regulated, growth inhibitor - family with sequence similarity 73, member B - tubulointerstitial nephritis antigen-like 1 - family with sequence similarity 76, member B |