Cart 13 Product Products 1 676,71 € (empty)
-
1 x ZNF616-zin...113,40 € -
1 x MAB21L1-ma...121,50 € -
1 x RNASE3-rib...113,40 € -
1 x HLA-DQA1-m...113,40 € -
1 x EIF2B2-euk...121,50 € -
1 x SREC-II...259,07 € -
1 x CXXC5-CXXC...121,50 € -
1 x HLA-DPA1-m...113,40 € -
1 x TGDS-TDP-g...121,50 € -
1 x C14orf65-c...113,40 € -
1 x C11orf65-c...121,50 € -
1 x FAM118A-fa...121,50 € -
No products
To be determined Shipping
1 676,71 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 676,71 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 676,71 €
Data sheet of KIAA0831-KIAA0831 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA0831-KIAA0831 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109090 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA0831 |
| Origin species: | Human |
| Product name: | KIAA0831-KIAA0831 Gene |
| Size: | 2ug |
| Accessions: | BC109090 |
| Gene id: | 22863 |
| Gene description: | KIAA0831 |
| Synonyms: | KIAA0831; ATG14L; BARKOR; beclin 1-associated autophagy-related key regulator; ATG14 autophagy related 14 homolog; Beclin 1-Interacting protein; autophagy-related protein 14-like protein; autophagy related 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtctcccagtgggaagggagcccgggcgctggaggctcctggctgcgggccccggccgctcgcccgggacctggtggactccgtggacgatgcggaggggctgtacgtggctgtggagcgctgcccgctgtgcaacactacccgccggcggctgacctgcgccaaatgcgttcagagcggcgatttcgtctacttcgacggccgcgaccgggagaggtttatcgacaagaaggaaaggttaagccgacttaagagcaagcaagaagaatttcagaaagaagtgttaaaagctatggaaggaaaatggataacagatcagttgagatggaaaataatgtcctgcaagatgaggattgaacagttaaaacaaacaatatgtaaaggaaatgaagaaatggagaaaaattctgaaggccttctcaaaaccaaggaaaagaatcagaagctttacagtcgagcacaacggcaccaagagaaaaaggagaagattcagaggcataatcgcaaacttggtgacctggtagaaaaaaagaccattgacttaagaagtcattatgagcgtctggcaaatcttcgacgatcccatatattagagctcacctctgtcatttttccaatcgaggaagtaaagacgggtgtgagagaccccgcagatgtgtcttcagagagtgacagtgccatgacctccagcactgtgagcaagcttgctgaagcccggaggacaacttacctctcaggacgatgggtctgtgacgatcacaacggagacaccagcattagcattacagggccttggattagcctccctaacaatggggactactctgcctactacagctgggtggaggagaagaaaacaacccaggggcctgacatggagcagagtaaccctgcctacaccatcagtgctgcgctgtgctatgcaactcagctggtcaacattctgtctcatatacttgatgtaaatcttcccaaaaagctctgcaacagtgaattttgtggcgaaaatctaagcaagcagaaatttactcgagcagtgaagaaactgaatgcaaatattctttacctttgtttttctcagcatgtaaatttagatcaattacaaccactgcataccctcaggaatctaatgtacctggtcagtccaagctctgaacacctaggcaggtcagggccctttgaagtacgagcagaccttgaggagtccatggaatttgtggatcccggagttgctggagaatcagatgagagcggagatgagcgcgtcagcgatgaagaaaccgacctgggcacagactgggagaacttgcctagtccccggttttgtgatatcccttcccagtctgtggaagtctcccagagtcagagcacccaggcgtccccacccatcgcgagcagcagtgcaggtgggatgatctcctctgcagcagcctcggtgacctcctggtttaaagcttacactggacaccgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gasdermin A - paired box 4 - FLJ44881 - cystatin 11 |