Cart 11 Product Products 1 274,51 € (empty)
-
1 x TSSC4-tumo...121,50 € -
1 x ZC3H7A-zin...113,40 € -
1 x AKR7A2-ald...121,50 € -
-
1 x EBAG9-estr...113,40 € -
1 x CHST4-carb...121,50 € -
1 x MYL6-myosi...113,40 € -
1 x MUSTN1-mus...113,40 € -
1 x RASGEF1B-R...121,50 € -
-
1 x MYL2-myosi...113,40 €
No products
To be determined Shipping
1 274,51 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 274,51 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 274,51 €
View larger 
CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene
PTXBC117122
New product
Data sheet of CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC117122 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CNDP1 |
| Origin species: | Human |
| Product name: | CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene |
| Size: | 2ug |
| Accessions: | BC117122 |
| Gene id: | 84735 |
| Gene description: | carnosine dipeptidase 1 (metallopeptidase M20 family) |
| Synonyms: | CN1; CPGL2; HsT2308; beta-Ala-His dipeptidase; CNDP dipeptidase 1; carnosinase 1; carnosine dipeptidase 1 (metallopeptidase M20 family); glutamate carboxypeptidase-like protein 2; serum carnosinase; carnosine dipeptidase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtggccatcgagagcgactctgtccagcctgtgcctcgcttcagacaagagctcttcagaatgatggccgtggctgcggacacgctgcagcgcctgggggcccgtgtggcctcggtggacatgggtcctcagcagctgcccgatggtcagagtcttccaatacctcccgtcatcctggccgaactggggagcgatcccacgaaaggcaccgtgtgcttctacggccacttggacgtgcagcctgctgaccggggcgatgggtggctcacggacccctatgtgctgacggaggtagacgggaaactttatggacgaggagcgaccgacaacaaaggccctgtcttggcttggatcaatgctgtgagcgccttcagagccctggagcaagatcttcctgtgaatatcaaattcatcattgaggggatggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttacggaacccgggggaacagctacttcatggtggaggtgaaatgcagagaccaggattttcactcaggaacctttggtggcatccttcatgaaccaatggctgatctggttgctcttctcggtagcctggtagactcgtctggtcatatcctggtccctggaatctatgatgaagtggttcctcttacagaagaggaaataaatacatacaaagccatccatctagacctagaagaataccggaatagcagccgggttgagaaatttctgttcgatactaaggaggagattctaatgcacctctggaggtacccatctctttctattcatgggatcgagggcgcgtttgatgagcctggaactaaaacagtcatacctggccgagttataggaaaattttcaatccgtctagtccctcacatgaatgtgtctgcggtggaaaaacaggtgacacgacatcttgaagatgtgttctccaaaagaaatagttccaacaagatggttgtttccatgactctaggactacacccgtggattgcaaatattgatgacacccagtatctcgcagcaaaaagagcgatcagaacagtgtttggaacagaaccagatatgatccgggatggatccaccattccaattgccaaaatgttccaggagatcgtccacaagagcgtggtgctaattccgctgggagctgttgatgatggagaacattcgcagaatgagaaaatcaacaggtggaactacatagagggaaccaaattatttgctgcctttttcttagagatggcccagctccattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP glucuronosyltransferase 2 family, polypeptide A3 - carnosine dipeptidase 1 (metallopeptidase M20 family) - wingless-type MMTV integration site family, member 3A - potassium channel tetramerisation domain containing 8 |