Cart 25 Product Products 3 605,88 € (empty)
-
1 x Cortisol...339,00 € -
-
1 x KLK10-kall...121,50 € -
-
-
-
1 x HMGN1-high...113,40 € -
1 x ZIM3-zinc...121,50 € -
-
1 x MYL6B-myos...113,40 € -
-
-
-
-
1 x STK32B-ser...121,50 € -
-
-
1 x CAMK1G-cal...121,50 € -
1 x CAPSL-calc...113,40 € -
1 x HIST1H4H-h...113,40 € -
1 x Mas1...259,07 € -
-
1 x TINAGL1-tu...121,50 € -
1 x TSHR-thyro...113,40 € -
No products
To be determined Shipping
3 605,88 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 25 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 605,88 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 605,88 €
Data sheet of FZD2-frizzled homolog 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FZD2-frizzled homolog 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC113402 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FZD2 |
| Origin species: | Human |
| Product name: | FZD2-frizzled homolog 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC113402 |
| Gene id: | 2535 |
| Gene description: | frizzled homolog 2 (Drosophila) |
| Synonyms: | Fz2; fz-2; fzE2; hFz2; frizzled-2; frizzled 2, seven transmembrane spanning receptor; frizzled family receptor 2; frizzled homolog 2; frizzled class receptor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggccccgcagcgccctgccccgcctgctgctgccgctgctgctgctgcccgccgccgggccggcccagttccacggggagaagggcatctccatcccggaccacggcttctgccagcccatctccatcccgctgtgcacggacatcgcctacaaccagaccatcatgcccaaccttctgggccacacgaaccaggaggacgcaggcctagaggtgcaccagttctatccgctggtgaaggtgcagtgctcgcccgaactgcgcttcttcctgtgctccatgtacgcacccgtgtgcaccgtgctggaacaggccatcccgccgtgccgctctatctgtgagcgcgcgcgccagggctgcgaagccctcatgaacaagttcggttttcagtggcccgagcgcctgcgctgcgagcacttcccgcgccacggcgccgagcagatctgcgtcggccagaaccactccgaggacggagctcccgcgctactcaccaccgcgccgccgccgggactgcagccgggtgccgggggcaccccgggtggcccgggcggcggcggcgctcccccgcgctacgccacgctggagcaccccttccactgcccgcgcgtcctcaaggtgccatcctatctcagctacaagtttctgggcgagcgtgattgtgctgcgccctgcgaacctgcgcggcccgatggttccatgttcttctcacaggaggagacgcgtttcgcgcgcctctggatcctcacctggtcggtgctgtgctgcgcttccaccttcttcactgtcaccacgtacttggtagacatgcagcgcttccgctacccagagcggcctatcatttttctgtcgggctgctacaccatggtgtcggtggcctacatcgcgggcttcgtgctccaggagcgcgtggtgtgcaacgagcgcttctccgaggacggttaccgcacggtggtgcagggcaccaagaaggagggctgcaccatcctcttcatgatgctctacttcttcagcatggccagctccatctggtgggtcatcctgtcgctcacctggttcctggcagccggcatgaagtggggccacgaggccatcgaggccaactctcagtacttccacctggccgcctgggccgtgccggccgtcaagaccatcaccatcctggccatgggccagatcgacggcgacctgctgagcggcgtgtgcttcgtaggcctcaacagcctggacccgctgcggggcttcgtgctagcgccgctcttcgtgtacctgttcatcggcacgtccttcctcctggccggcttcgtgtcgctcttccgcatccgcaccatcatgaagcacgacggcaccaagaccgaaaagctggagcggctcatggtgcgcatcggcgtcttctccgtgctctacacagtgcccgccaccatcgtcatcgcttgctacttctacgagcaggccttccgcgagcactgggagcgctcgtgggtgagccagcactgcaagagcctggccatcccgtgcccggcgcactacacgccgcgcatgtcgcccgacttcacggtctacatgatcaaatacctcatgacgctcatcgtgggcatcacgtcgggcttctggatctggtcgggcaagacgctgcactcgtggaggaagttctacactcgcctcaccaacagccgacacggtgagaccaccgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin associated protein 1 - 5'-nucleotidase, cytosolic IA - unc-93 homolog A (C. elegans) - SEC14-like 3 (S. cerevisiae) |