Cart 26 Product Products 3 636,46 € (empty)
-
-
1 x C6orf168-c...121,50 € -
1 x FAM122C-fa...113,40 € -
1 x MR1-major...121,50 € -
-
1 x FLJ34048-h...113,40 € -
1 x MPHOSPH6-M...113,40 € -
1 x SYP-synapt...121,50 € -
1 x FAM151B-fa...121,50 € -
-
1 x SLC48A1-so...113,40 € -
1 x MRPL44-mit...121,50 € -
1 x PSMB7-prot...121,50 € -
1 x LINCR-like...113,40 € -
-
-
1 x PTPN7-prot...121,50 € -
1 x NAPRT1-nic...121,50 € -
1 x C2orf56-ch...113,40 € -
1 x PPIL1-pept...113,40 € -
1 x DUSP13-dua...113,40 € -
1 x C17orf89-c...113,40 € -
1 x LRRN4CL-LR...113,40 € -
1 x INPP1-inos...121,50 € -
1 x NRBF2-nucl...121,50 € -
1 x KLRAQ1-KLR...121,50 €
No products
To be determined Shipping
3 636,46 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 26 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 636,46 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 636,46 €
Data sheet of FLJ33590-hypothetical protein FLJ33590 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ33590-hypothetical protein FLJ33590 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC113517 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ33590 |
| Origin species: | Human |
| Product name: | FLJ33590-hypothetical protein FLJ33590 Gene |
| Size: | 2ug |
| Accessions: | BC113517 |
| Gene id: | 285093 |
| Gene description: | hypothetical protein FLJ33590 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaccgggctggggcagacatgtgggccagcaccttcaccctggccatggccgagaggaagccccaggacgtctgggttctgctacctgagcacagcctggtcccgggatgcctggacggcggtggtgtccagtacctgctggtggggctctcgaggctccagtgcggtcactgtccggggacctgggactcggcccatgtgcacgtcctcttccacctgtggtgggacagggccagccaccgggggctggtgaagatgcgcatctggggccagcggtgcaggctgtgccccgcacccgaggactgccaggtgaggcccccgggcgagcagcccttcctcagcaggctggtcttgcacatcctgcaggactgctacggggatggccccggcccagcccggcaccccagggaggcctatgagggctgctgtgaggcctgtgagctgggggtctgcttcctccagaaggccccagaccccgcctggagcgccaacgccacaaaaggcaacttccccgccacggcctggggtggcactggcaccgtctccaggggcaaaccgctgtccacccctggcgacgaccttggcaagggtggcgttgtcatcgccatccccttctcccttgtgggtaccagcaatgaccaggtgcccatcgctgagggccctgccccccctgcgggggcctctctccctgtgactggcagctgtgaggccctggtcatcggccagggctccatcttcctgtctggggattcagtggccatgcctgggggcaaaggcttcccggtggccattggagaccccctcttccacggccccggcctcctcggcagcagcatccagaccttcgagctcaagggcttcctcttcaaaggccggggctccctctgcagcccggttggcgtggcccagggctggggccccatctccctcaacaatggcctcgtccctgtggggaaacacacgccaaccgtgttctactgtgtgggcctctcggccagcggggagggctccctcaccttcccctcctccctcaccagcatcttcaccaacaccctctcggagcccaccgatggccctgtggccactaaagaggcctccatcaccttccccttcatctttactgatgtcaaggatgccgttgctgaggtggctgaaggcaacgggaaggaaggaggcggccagggcctcgtcccagtgggtcacgacgccctgccagagaccaatgctggtggcctcccctcccaggtcaagggctcccttgccctccccttccctgctgatgtccaaggcaaagatgcctttactgacatcactgaaggcaaagagaaggaaggtggcctggtcaccgcgggtcacgacgcccctctggaggccaatgccgagggccccatcacggttagtgagggctgcatcaccatccccttcgcagtcttcgatgtcataaagcgcaagggcggtggccacgttgcctacggcccccagggcaatggctgcttctcccaaggctattaccagaagaggcagctgaggtccaggttccacaaggcccgctgtgggtgccgccgggaggaagacgagcgccctggccgtgcctgccgtaggccgcacgccgagccctacgaggacttctggatctgggtgtccatgaccgtgtgcgtcttctggctgatgtgcatgtgtcggctgaaccccgggatctacccgcagcaagtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SET and MYND domain containing 1 - ADAM metallopeptidase domain 10 - Src homology 2 domain containing E - transducin (beta)-like 1Y-linked |