Cart 89 Product Products 25 769,61 € (empty)
-
-
1 x MRPL14-mit...113,40 € -
1 x PFDN5-pref...113,40 € -
1 x HSD11B1L-h...113,40 € -
1 x BCAS1-brea...121,50 € -
1 x PARP6-poly...113,40 € -
-
-
1 x C17orf62-c...113,40 € -
1 x C3AR1-comp...121,50 € -
1 x RTN4-retic...121,50 € -
-
-
-
1 x CEP170L-ce...121,50 € -
1 x KLHL20-kel...113,40 € -
1 x PPAN-peter...121,50 € -
1 x SRPX2-sush...121,50 € -
1 x E2F3-E2F...113,40 € -
1 x HLA-A-majo...121,50 € -
1 x MMD-monocy...113,40 € -
1 x C10orf116-...113,40 € -
1 x CPLX2-comp...113,40 € -
1 x FAM134B-fa...113,40 € -
1 x ITPK1-inos...121,50 € -
1 x TPTE2-tran...121,50 € -
1 x FAM182A-fa...113,40 € -
1 x StARD13...259,07 € -
1 x CD69-CD69...113,40 € -
1 x SH2D1B-SH2...113,40 € -
1 x C3orf23-ch...121,50 € -
1 x C6orf106-c...121,50 € -
1 x TFF3-trefo...113,40 € -
1 x HLA-DRB1-m...121,50 € -
1 x FCER1G-Fc...113,40 € -
-
-
1 x SPATA17-sp...121,50 € -
1 x GOPC-golgi...121,50 € -
1 x ZNF187-zin...121,50 € -
1 x LHFP-lipom...113,40 € -
1 x ACMSD-amin...121,50 € -
1 x MITF-micro...113,40 € -
1 x FAM83A-fam...121,50 € -
1 x MGC119295-...113,40 € -
-
-
-
1 x SLC38A6-so...121,50 € -
-
-
1 x C3orf26-ch...121,50 € -
1 x FAM173B-fa...113,40 € -
1 x ZMPSTE24-z...121,50 € -
1 x C2orf52-ch...113,40 € -
1 x C2orf54-ch...121,50 € -
1 x LOC348174-...121,50 € -
-
1 x CTAG2-canc...113,40 € -
1 x Rab 33A...259,07 € -
1 x ENO3-enola...121,50 € -
1 x EIF3H-euka...121,50 € -
1 x MANBAL-man...113,40 € -
1 x CREB1-cAMP...121,50 € -
1 x C6orf134-c...113,40 € -
1 x RGS20-regu...113,40 € -
1 x C10orf25-c...113,40 € -
1 x LYVE1-lymp...121,50 € -
1 x PYCRL-pyrr...121,50 € -
1 x CD32-C...259,07 € -
-
1 x OTUD6B-OTU...121,50 € -
1 x C17orf81-c...121,50 € -
1 x VSIG2-V-se...121,50 € -
1 x RMI1-RMI1,...121,50 € -
1 x FGF9-fibro...113,40 € -
1 x FAM153C-fa...113,40 € -
1 x RFC3...259,07 € -
1 x C11orf63-c...113,40 € -
1 x KLHL35-kel...121,50 € -
1 x C2orf51-ch...113,40 € -
1 x SPSB3-splA...113,40 € -
1 x C17orf87-c...113,40 € -
1 x SIGIRR-sin...121,50 € -
1 x NIPA2-non...121,50 € -
1 x FAM151A-fa...121,50 € -
1 x PSMD12-pro...121,50 € -
1 x SLPI-secre...113,40 € -
1 x ALKBH3-alk...121,50 €
No products
To be determined Shipping
25 769,61 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 89 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 25 769,61 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 25 769,61 €
View larger 
SMPD3-sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II) Gene
PTXBC112238
New product
Data sheet of SMPD3-sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMPD3-sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC112238 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMPD3 |
| Origin species: | Human |
| Product name: | SMPD3-sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II) Gene |
| Size: | 2ug |
| Accessions: | BC112238 |
| Gene id: | 55512 |
| Gene description: | sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II) |
| Synonyms: | NSMASE2; sphingomyelin phosphodiesterase 3; nSMase-2; neutral sphingomyelinase 2; neutral sphingomyelinase II |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttttgtacacgaccccctttcctaacagctgtctgtccgccctgcactgtgtgtcctgggcccttatctttccatgctactggctggtggaccggctcgctgcctccttcatacccaccacctacgagaagcgccagcgggcagacgacccgtgctgcctgcagctgctctgcactgccctcttcacgcccatctacctggccctcctggtggcctcgctgccctttgcgtttctcggctttctcttctggtccccactgcagtcggcccgccggccctacatctattcacggctggaagacaagggcctggccggtggggcagccctgctcagtgaatggaagggcacggggcctggcaaaagcttctgctttgccactgccaacgtctgcctcctgcccgactcactcgccagggtcaacaacctttttaacacccaagcgcgggccaaggagatcgggcagagaatccgcaatggggccgcccggccccagatcaaaatttacatcgactcccccaccaatacctccatcagcgccgctagcttcagcagcctggtgtcaccacagggcggcgatggggtggcccgggccgtccccgggagcattaagaggacagcctctgtggagtacaagggtgacggtgggcggcaccccggtgacgaggctgccaacggcccagcctctggggaccctgtcgacagcagcagcccggaggatgcctgcatcgtgcgcatcggtggcgaggagggcggccggccacctgaagctgacgaccctgtgcctgggggccaggccaggaacggagctggcgggggcccaaggggccagacgcccaaccataatcagcaggacggggattcagggagcctgggcagcccctcggcctcccgggagtccctggtgaaggggcgagctgggccagacaccagtgccagcggggagccaggtgccaacagcaagctcctgtacaaggcctcggtggtgaagaaggcggctgcacgcaggaggcggcaccccgacgaggccttcgaccatgaggtctccgccttcttccccgccaacctggacttcctgtgcctgcaggaggtgtttgacaagcgagcagccaccaaattgaaagagcagctgcacggctacttcgagtacatcctgtacgacgtcggggtctacggctgccagggctgctgcagcttcaagtgtctcaacagcggcctcctctttgccagccgctaccccatcatggacgtggcctatcactgttaccccaacaagtgtaacgacgatgccctggcctctaagggagctctgtttctcaaggtgcaggtgggaagcacacctcaggaccaaagaatcgtcgggtacatcgcctgcacacacctgcatgccccgcaagaggacagcgccatccggtgtgggcagctggacctgcttcaggactggctggctgatttccgaaaatctacctcctcgtccagcgcagccaaccccgaggagctggtggcatttgacgtcgtctgtggagatttcaactttgataactgctcctctgacgacaagctggagcagcaacactccctgttcacccactacagggacccctgccgcctggggcctggtgaggagaagccgtgggccatcggtactctgctggacacgaacggcctgtacgatgaggatgtgtgcacccccgacaacctgcagaaggtcctggagagtgaggagggccgcagggagtacctggcgtttcccaccagcaagagctcgggccagaaggggcggaaggagctgctgaagggcaacggccggcgcatcgactacatgctgcatgcagaggaggggctgtgcccagactggaaggccgaggtggaagaattcagttttatcacccagctgtccggcctgacggaccacctgccagtagccatgcgactgatggtgtcttcgggggaggaggaggcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) - fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) - solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 - solute carrier family 7, (cationic amino acid transporter, y+ system) member 13 |