Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene
PTXBC119678
New product
Data sheet of TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC119678 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TAF8 |
| Origin species: | Human |
| Product name: | TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene |
| Size: | 2ug |
| Accessions: | BC119678 |
| Gene id: | 129685 |
| Gene description: | TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa |
| Synonyms: | TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa; TAF; TAFII-43; TAFII43; TBN; transcription initiation factor TFIID subunit 8; TAF(II)43; TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 45/50kDa; TBP-associated factor 43 kDa; TBP-associated factor 8; TBP-associated factor TAFII43; TBP-associated factor, RNA polymerase II, 43 kD; hTAFII43; protein taube nuss; taube nuss homolog; transcription initiation factor TFIID 43 kDa subunit; TATA-box binding protein associated factor 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgacgcggcggccacagctggggccggtggctccggaacgagatcgggaagtaaacagtccactaaccctgccgataactatcatctggcccggaggagaaccctgcaggtggttgtgagctccttgctgacagaggcagggtttgagagtgccgagaaagcatccgtggaaacgctgacagagatgctgcagagctacatttcagaaattgggagaagtgccaagtcttactgtgagcacacagccaggacccagcccacactgtccgatatcgtggtcacacttgttgagatgggtttcaatgtggacactctccctgcttatgcaaaacggtctcagaggatggtcatcactgctcctccggtgaccaatcagccagtgacccccaaggccctcactgcagggcagaaccgaccccacccgccgcacatccccagccattttcctgagttccctgatccccacacctacatcaaaactccgacgtaccgtgagcccgtgtcagactaccaggtcctgcgggagaaggctgcatcccagaggcgcgatgtggagcgggcacttacccgtttcatggccaagacaggcgagactcagagtcttttcaaagatgacgtcagcacatttccattgattgctgccagacctttcaccatcccctacctgacagctcttcttccgtctgaactggagatgcaacaaatggaagagacagattcctcggagcaggatgaacagacagacacagagaaccttgctcttcatatcagcatggaggattctggagccgagaaggagaacacctctgtcctgcagcagaacccctccttgtcgggtagccggaatggggaggagaacatcatcgataacccttatctgcggccggtgaagaagcccaagatccgcaggaagaagccagatacattctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa - similar to metallo-beta-lactamase superfamily protein - biogenesis of lysosomal organelles complex-1, subunit 2 - ribosomal modification protein rimK-like family member B |