Cart 13 Product Products 1 829,71 € (empty)
-
1 x C10orf97-c...121,50 € -
1 x Ameloblast...259,07 € -
-
1 x HERPUD1-ho...121,50 € -
1 x OLAH-oleoy...113,40 € -
1 x HDHD2-halo...113,40 € -
1 x GGTA1-glyc...113,40 € -
-
1 x CRB3-crumb...113,40 € -
1 x HDHD1A-hal...113,40 € -
-
-
1 x PPIE-pepti...121,50 €
No products
To be determined Shipping
1 829,71 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 829,71 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 829,71 €
Data sheet of KIAA1303-raptor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA1303-raptor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064515 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA1303 |
| Origin species: | Human |
| Product name: | KIAA1303-raptor Gene |
| Size: | 2ug |
| Accessions: | BC064515 |
| Gene id: | 57521 |
| Gene description: | raptor |
| Synonyms: | KOG1; Mip1; regulatory-associated protein of mTOR; p150 target of rapamycin (TOR)-scaffold protein containing WD-repeats; regulatory associated protein of MTOR complex 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtccgaaatgctgcaatcgcctcttctgggcctgggggaggaagatgaggctgatcttacagactggaacctacctttggcttttatgaaaaagaggcactgtgagaaaattgaaggctccaaatccttagctcagagctggaggatgaaggatcggatgaagacagtcagtgttgccttagttttgtgcctgaatgttggtgtggaccctcccgatgtggtgaagaccacgccctgtgcacgcttggaatgctggatcgatcctctgtcgatgggtcctcagaaagctctggaaaccatcggtgcaaatttacagaagcagtacgagaactggcagccaagggcccggtacaagcagagccttgacccaactgtggatgaagtcaagaagctctgcacgtccttacgtcgcaacgccaaggaggagcgagtcctctttcactacaatggccacggggtgccccggcccacagtcaacggggaggtctgggtcttcaacaagaactacacgcagtacatccctctgtccatatatgacctgcagacgtggatgggcagcccgtcgatcttcgtctacgactgctccaatgctggcttgatcgtcaagtccttcaagcagttcgcactacagcgggagcaggagctggaggtagctgcaatcaacccaaatcaccctcttgctcagatgcctttgcctccgtcgatgaaaaactgcatccagctggcagcctgcgaggccaccgagctgctgcccatgatccccgacctcccggctgacctattcacctcctgcctcaccacccccatcaagatcgccctgcgctggttttgcatgcagaaatgtgtcagtctggtgcctggcgtcacactggatttgatagaaaagatccctggccgcctgaacgacaggaggacgcccctgggtgaactgaactggatcttcacagccatcacagacaccatcgcgtggaacgtgctcccccgggatctcttccaaaagctcttcagacaggacttgctggtggctagtctgtttcgaaattttttattggcggaaaggattatgaggtcgtataactgcactcccgtcagcagcccgcgtctgccgcccacgtacatgcacgccatgtggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heparanase - oncomodulin - caveolin 3 - cystatin D |