Cart 2 Product Products 219,67 € (empty)
-
-
1 x IL28A-inte...113,40 €
No products
To be determined Shipping
219,67 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 219,67 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 219,67 €
Data sheet of PI16-peptidase inhibitor 16 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PI16-peptidase inhibitor 16 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022399 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PI16 |
| Origin species: | Human |
| Product name: | PI16-peptidase inhibitor 16 Gene |
| Size: | 2ug |
| Accessions: | BC022399 |
| Gene id: | 221476 |
| Gene description: | peptidase inhibitor 16 |
| Synonyms: | CD364; CRISP9; MSMBBP; PSPBP; peptidase inhibitor 16; PSP94-binding protein; cysteine-rich secretory protein 9; microseminoprotein, beta-binding protein; protease inhibitor 16 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacggctcctgcagtttcctgatgcttctgctgccgctactgctactgctggtggccaccacaggccccgttggagccctcacagatgaggagaaacgtttgatggtggagctgcacaacctctaccgggcccaggtatccccgacggcctcagacatgctgcacatgagatgggacgaggagctggccgccttcgccaaggcctacgcacggcagtgcgtgtggggccacaacaaggagcgcgggcgccgcggcgagaatctgttcgccatcacagacgagggcatggacgtgccgctggccatggaggagtggcaccacgagcgtgagcactacaacctcagcgccgccacctgcagcccaggccagatgtgcggccactacacgcaggtggtatgggccaagacagagaggatcggctgtggttcccacttctgtgagaagctccagggtgttgaggagaccaacatcgaattactggtgtgcaactatgagcctccggggaacgtgaaggggaaacggccctaccaggaggggactccgtgctcccaatgtccctctggctaccactgcaagaactccctctgtgaacccatcggaagcccggaagatgctcaggatttgccttacctggtaactgaggccccatccttccgggcgactgaagcatcagactctaggaaaatgggtactccttcttccctagcaacggggattccggctttcttggtaacagaggtctcaggctccctggcaaccaaggctctgcctgctgtggaaacccaggccccaacttccttagcaacgaaagacccgccctccatggcaacagaggctccaccttgcgtaacaactgaggtcccttccattttggcagctcacagcctgccctccttggatgaggagccagttaccttccccaaatcgacccatgttcctatcccaaaatcagcagacaaagtgacagacaaaacaaaagtgccctctaggagcccagagaactctctggaccccaagatgtccctgacaggggcaagggaactcctaccccatgcccaggaggaggctgaggctgaggctgagttgcctccttccagtgaggtcttggcctcagtttttccagcccaggacaagccaggtgagctgcaggccacactggaccacacggggcacacctcctccaagtccctgcccaaatttccccaatacctctgccaccgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - angiopoietin-like 3 - lipoic acid synthetase - ribosomal protein L23 - interleukin 9 receptor |