PTXBC017868
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC017868 |
Product type: | DNA & cDNA |
Ncbi symbol: | FAM122C |
Origin species: | Human |
Product name: | FAM122C-family with sequence similarity 122C Gene |
Size: | 2ug |
Accessions: | BC017868 |
Gene id: | 159091 |
Gene description: | family with sequence similarity 122C |
Synonyms: | protein FAM122C; family with sequence similarity 122C |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcacaggagaaaatgaaactaggtttcaagtcgctgccgagttccactaccgcagacggcaacattctgagaagagtcaacagtgcccctttgatcaatggacttggttttaattcacaggtgttgcaagctgacatgttaagaattaggacaaacagaacaacatttaggaatcgacgctctctgttgttgccacctcctccctttcatggttccatcagccgccttcatcaaatcaaacaggaagaagccatggatttaataaatagagaaacaatgtctgaatggaagctacaaagtgagatacagataagtcactcttgggaagaaggcttgaaactgaatgacaatggcttacagaaatcatcctctctaaagtgcattgatttaactccagtatcctcaatggcttcttccatcaagaagactgggaagtctacttccagctacttttga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - hepatitis A virus cellular receptor 2 - chromosome 16 open reading frame 63 - chromosome 10 open reading frame 97 - glycoprotein hormones, alpha polypeptide |