Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MFAP3L-microfibrillar-associated protein 3-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MFAP3L-microfibrillar-associated protein 3-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001279 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MFAP3L |
| Origin species: | Human |
| Product name: | MFAP3L-microfibrillar-associated protein 3-like Gene |
| Size: | 2ug |
| Accessions: | BC001279 |
| Gene id: | 9848 |
| Gene description: | microfibrillar-associated protein 3-like |
| Synonyms: | NYD-sp9; microfibrillar-associated protein 3-like; microfi brillar-associated protein 3-like; testis development protein NYD-SP9; microfibrillar associated protein 3 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatcgattgaagagccatctgactgtgtgctttctaccttctgtgccctttttaatcctagtatccactctagccaccgctaagagtgtgactaacagcactttaaatggcactaacgtggtcttgggctctgtgcccgtaatcattgccagaactgaccatatcatagtcaaggaagggaacagtgccttgattaactgtagtgtttatggcatccctgacccacagttcaagtggtataattccattggcaagctgctgaaagaagaagaggatgagaaggagagaggaggaggtaggctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neuropilin (NRP) and tolloid (TLL)-like 2 - zinc finger and BTB domain containing 24 - emopamil binding protein (sterol isomerase) - splicing factor, arginine/serine-rich 16 |