Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT9P1-nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1 Gene
PTXBC029544
New product
Data sheet of NUDT9P1-nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT9P1-nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029544 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT9P1 |
| Origin species: | Human |
| Product name: | NUDT9P1-nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1 Gene |
| Size: | 2ug |
| Accessions: | BC029544 |
| Gene id: | 119369 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggatccaggagagaaaattagtgctacattgaagagagaatttggcgaggaagccatgaactctttacagaaatctaggaaagaaatgcaggagttggagagacaattgcacaaactcctcagtcaggaacattttgaggtctataaaggctacgtggatgattctagaaacacagataactgctggatagagacagaggctgtgaactaccgtgatgaaataatggaccatcttcctctggaagctggcgatgatgccaagaaagtgaaatgggtggacattaatgataaacttgagctttatgccagcctctcccaatttattcaacttgtggctgagaaacgaggtgcccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) - sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like - aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase - guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 |