Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ROPN1B-ropporin, rhophilin associated protein 1B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ROPN1B-ropporin, rhophilin associated protein 1B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015413 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ROPN1B |
| Origin species: | Human |
| Product name: | ROPN1B-ropporin, rhophilin associated protein 1B Gene |
| Size: | 2ug |
| Accessions: | BC015413 |
| Gene id: | 152015 |
| Gene description: | ropporin, rhophilin associated protein 1B |
| Synonyms: | ropporin-1B; AKAP-binding sperm protein ropporin; rhophilin-associated protein 1B; ropporin, rhophilin associated protein 1B; testis tissue sperm-binding protein Li 83P; rhophilin associated tail protein 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggaaagtggtgaatctcccaacagatctgtttaatagtgtgatgaatgtgggtcgcttcacggaggagatcgagtggctgaagtttttagcccttgcttgcagcgctctgggagttactattaccaaaactctcaagatagtgtgtgaggtcttatcatgtgaccacaatggtgggttgccccgaatcccattcagcaccttccagtttctctacacgtatattgccgaagtggatggggagatctgtgcatcacatgtcagcaggatgctaaactacattgaacaggaagtaattggtcctgatggtttaatcacggtgaatgactttacccaaaaccccagggtttggctggagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2 variant 2 - calmodulin 1 (phosphorylase kinase, delta) - calmodulin 3 (phosphorylase kinase, delta) - calmodulin 2 (phosphorylase kinase, delta) |