Cart 2 Product Products 233,54 € (empty)
-
1 x ISG20L2-in...121,50 € -
No products
To be determined Shipping
233,54 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 233,54 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 233,54 €
Data sheet of CASC4-cancer susceptibility candidate 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CASC4-cancer susceptibility candidate 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012124 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CASC4 |
| Origin species: | Human |
| Product name: | CASC4-cancer susceptibility candidate 4 Gene |
| Size: | 2ug |
| Accessions: | BC012124 |
| Gene id: | 113201 |
| Gene description: | cancer susceptibility candidate 4 |
| Synonyms: | protein CASC4; H63; cancer susceptibility candidate gene 4 protein; gene associated with HER-2/neu overexpression; cancer susceptibility candidate 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgggtttcggggccaaccggcgggctggccgcctgccctctctcgtgctggtggtgctgctggtggtgatcgtcgtcctcgccttcaactactggagcatctcctcccgccacgtcctgcttcaggaggaggtggccgagctgcagggccaggtccagcgcaccgaagtggcccgcgggcggctggaaaagcgcaattcggacctcttgctgttggtggacacgcacaagaaacagatcgaccagaaggaggccgactacggccgcctcagcagccggctgcaggccagagagggcctcgggaagagatgcgaggatgacaaggttaaactacagaacaacatatcgtatcagatggcagacatacatcatttaaaggagcaacttgctgagcttcgtcaggaatttcttcgacaagaagaccagcttcaggactataggaagaacaatacttaccttgtgaagaggttagaatatgaaagcaagagacccaaaagattcaatcaaatgatggaaaggaattggatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 53 - RAB9A, member RAS oncogene family - RAB30, member RAS oncogene family - RAB6B, member RAS oncogene family |