Cart 1 Product Products 112,04 € (empty)
No products
To be determined Shipping
112,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 112,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 112,04 €
Data sheet of MGC16025-hypothetical protein MGC16025 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC16025-hypothetical protein MGC16025 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008026 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC16025 |
| Origin species: | Human |
| Product name: | MGC16025-hypothetical protein MGC16025 Gene |
| Size: | 2ug |
| Accessions: | BC008026 |
| Gene id: | 85009 |
| Gene description: | hypothetical protein MGC16025 |
| Synonyms: | uncharacterized LOC85009 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgtagggagacgcgcaccgagctggagacacagatctgcgaggagtaacttgcctctctcaccagcactgccaggggcggatcagcgccagcaccttccagcatgcgctaaactgctggagaagctggagtggctggaaggagccctgcctgcctgccctcctcctcctcagttgctggccttggcagctctagggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein MGC15634 - hypothetical protein MGC16121 - S100 calcium binding protein A1 - S100 calcium binding protein A4 |