PTXBC006244
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC006244 |
Product type: | DNA & cDNA |
Ncbi symbol: | C19orf62 |
Origin species: | Human |
Product name: | C19orf62-chromosome 19 open reading frame 62 Gene |
Size: | 2ug |
Accessions: | BC006244 |
Gene id: | 29086 |
Gene description: | chromosome 19 open reading frame 62 |
Synonyms: | C19orf62; HSPC142; MERIT40; NBA1; BRISC and BRCA1-A complex member 1; BRCA1-A complex subunit MERIT40; mediator of RAP80 interactions and targeting subunit of 40 kDa; mediator of Rap80 interactions and targeting 40 kDa; new component of the BRCA1-A complex; new component of the BRCAA1 A complex; BRISC and BRCA1 A complex member 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggaagtggcagagcccagcagccccactgaagaggaggaggaggaagaggagcactcggcagagcctcggccccgcactcgctccaatcctgaaggggctgaggaccgggcagtaggggcacaggccagcgtgggcagccgcagcgagggtgagggtgaggccgccagtgctgatgatgggagcctcaacacttcaggagccggccctaagtcctggcaggtgcccccgccagcccctgaggtccaaattcggacaccaagggtcaactgtccagagaaagtgattatctgcctggacctgtcagaggaaatgtcactgccaaagctggagtcgttcaacggctccaaaaccaacgccctcaatgtctcccagaagatgattgagatgttcgtgcggacaaaacacaagatcgacaaaagccacgagtttgcactggtggtggtgaacgatgacacggcctggctgtctggcctgacctccgacccccgcgagctctgtagctgcctctatgatctggagacggcctcctgttccaccttcaatctggaaggacttttcagcctcatccagcagaaaactgagcttccggtcacagagaacgtgcagacgattcccccgccatatgtggtccgcaccatccttgtctacagccgtccaccttgccagccccagttctccttgacggagcccatgaagaaaatgttccagtgcccatatttcttctttgacgttgtttacatccacaatggcactgaggagaaggaggaggagatgagttggaaggatatgtttgccttcatgggcagcctggataccaagggtaccagctacaagtatgaggtggcactggctgggccagccctggagttgcacaactgcatggcgaaactgttggcccaccccctgcagcggccttgccagagccatgcttcctacagcctgctggaggaggaggatgaagccattgaggttgaggccactgtctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - solute carrier family 25, member 39 - pyruvate dehydrogenase (lipoamide) beta - isocitrate dehydrogenase 3 (NAD+) beta - chromosome 16 open reading frame 35 |