Cart 1 Product Products 109,47 € (empty)
No products
To be determined Shipping
109,47 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 109,47 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 109,47 €
Data sheet of CCNI2-cyclin I family, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCNI2-cyclin I family, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC132837 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCNI2 |
| Origin species: | Human |
| Product name: | CCNI2-cyclin I family, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC132837 |
| Gene id: | 645121 |
| Gene description: | cyclin I family, member 2 |
| Synonyms: | cyclin-I2; cyclin I family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctcgggcgctcagctcccgccgcagccgtcgagctcagaggtcagcgccgtccagagcccaggcgggcgtcccggcgccggtctggaggaaacagccctgggcgttcctctcccgccgtctccgggggaggcccctctgccccgaagcaaccggagcaggtgccctgggacccgccagcccggagcggcctccctccacgcggcgtccgcagcagtccccgtgcggccccggcgcggtacggcgccagccgggaaaaccgcagacgcggtccccgccgccgccccagagcaagctccgcggccggctccacagtcccgcaagccgcgcaacctggaaggcgacctggacgagcgccggctgctctgccacttgcagctggcccaggaccgcgaggcgcgcctgtggcggggcggcaaaccccaggatgaaatctgcgacgccttcgaggaagtcgtgctgtggctcctgcggcttcagaacaccttttacttctcccagtccacttttaacctggccctcaccatctttggccgcctcctgatttcagtgaaggtaaaagagaaatacctgcattgcgccacaattacttccttgaggctcgctgcaaaagttaatgaagaagaggagtttattccacaagtaaaagacttcacaaagcactatggctctgactattccccgaatgagctgctgaggatggagctggctattctggacagactgcactgggacctctatattgggacgccgctggacttcttgactatattccatgccctggtggtcctgagctggccccatgtgttggagctgctgcctcagaggaatccttccctccacgtcgcatccctgaccaggcagctgcagcactgtatggcgggccaccagctgctgcagttcaagggctccacactggccttggtcatcatcaccttagagctggagaggctcatgcccggctggtgtgctcctatatctgatctgctaaagaaagcacaggttggtgatatgcagtacagctgctgcaaggaacttgtaatgcagcaactgagaagtcttcagtcatcctcctgcacagacaactttgtgtcacctgccaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neuropeptide S receptor 1 - HECT domain containing 3 - GRAM domain containing 4 - TNNI3 interacting kinase |