> >>EGLN3-egl nine homolog 3 (C. elegans) Gene
EGLN3-egl nine homolog 3 (C. elegans) Gene View larger

EGLN3-egl nine homolog 3 (C. elegans) Gene

PTXBC064924

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of EGLN3-egl nine homolog 3 (C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EGLN3-egl nine homolog 3 (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC064924
Product type: DNA & cDNA
Ncbi symbol: EGLN3
Origin species: Human
Product name: EGLN3-egl nine homolog 3 (C. elegans) Gene
Size: 2ug
Accessions: BC064924
Gene id: 112399
Gene description: egl nine homolog 3 (C. elegans)
Synonyms: HIFP4H3; HIFPH3; PHD3; egl nine homolog 3; HIF-PH3; HIF-prolyl hydroxylase 3; HPH-1; HPH-3; egl nine-like protein 3 isoform; hypoxia-inducible factor prolyl hydroxylase 3; prolyl hydroxylase domain-containing protein 3; egl-9 family hypoxia inducible factor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccctgggacacatcatgaggctggacctggagaaaattgccctggagtacatcgtgccctgtctgcacgaggtgggcttctgctacctggacaacttcctgggcgaggtggtgggcgactgcgtcctggagcgcgtcaagcagctgcactgcaccggggccctgcgggacggccagctggcggggccgcgcgccggcgtctccaagcgacacctgcggggcgaccagatcacgtggatcgggggcaacgaggagggctgcgaggccatcagcttcctcctgtccctcatcgacaggctggtcctctactgcgggagccggctgggcaaatactacgtcaaggagaggtctaaggcaatggtggcttgctatccgggaaatggaacaggttatgttcgccacgtggacaaccccaacggtgatggtcgctgcatcacctgcatctactatctgaacaagaattgggatgccaagctacatggtgggatcctgcggatatttccagaggggaaatcattcatagcagatgtggagcccatttttgacagactcctgttcttctggtcagatcgtaggaacccacacgaagtgcagccctcttacgcaaccagatatgctatgactgtctggtactttgatgctgaagaaagggcagaagccaaaaagaaattcaggaatttaactaggaaaactgaatctgccctcactgaagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TATA box binding protein like 2
- interleukin 20 receptor, alpha
- microtubule-associated protein 6
- ubiquitin specific peptidase 29

Reviews

Buy EGLN3-egl nine homolog 3 (C. elegans) Gene now

Add to cart