Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LY6K-lymphocyte antigen 6 complex, locus K Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LY6K-lymphocyte antigen 6 complex, locus K Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117142 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LY6K |
| Origin species: | Human |
| Product name: | LY6K-lymphocyte antigen 6 complex, locus K Gene |
| Size: | 2ug |
| Accessions: | BC117142 |
| Gene id: | 54742 |
| Gene description: | lymphocyte antigen 6 complex, locus K |
| Synonyms: | CT97; HSJ001348; URLC10; ly-6K; lymphocyte antigen 6K; cancer/testis antigen 97; up-regulated in lung cancer 10; lymphocyte antigen 6 complex, locus K |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggctccaaagaccccgacaggccccggcgggtgggaggcgcgcgccccggggcgggcggggctccccctaccggccagacccggggagaggcgcgcggaggctgcgaaggttccagaagggcggggagggggcgccgcgcgctgaccctccctgggcaccgctggggacgatggcgctgctcgccttgctgctggtcgtggccctaccgcgggtgtggacagacgccaacctgactgcgagacaacgagatccagaggactcccagcgaacggacgagggtgacaatagagtgtggtgtcatgtttgtgagagagaaaacactttcgagtgccagaacccaaggaggtgcaaatggacagagccatactgcgttatagcggccgtgaaaatatttccacgttttttcatggttgcgaagcagtgctccgctggttgtgcagcgatggagagacccaagccagaggagaagcggtttctcctggaagagcccatgcccttcttttacctcaagtgttgtaaaattcgctactgcaatttagaggggccacctatcaactcatcagtgttcaaagaatatgctgggagcatgggtgagagctgtggtgggctgtggctggccatcctcctgctgctggcctccattgcagccggcctcagcctgtcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 8 open reading frame 74 - chromosome X open reading frame 58 - chromosome 7 open reading frame 60 - chromosome 1 open reading frame 58 |