Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TIGIT-T cell immunoreceptor with Ig and ITIM domains Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIGIT-T cell immunoreceptor with Ig and ITIM domains Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101289 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIGIT |
| Origin species: | Human |
| Product name: | TIGIT-T cell immunoreceptor with Ig and ITIM domains Gene |
| Size: | 2ug |
| Accessions: | BC101289 |
| Gene id: | 201633 |
| Gene description: | T cell immunoreceptor with Ig and ITIM domains |
| Synonyms: | VSIG9; VSTM3; WUCAM; T-cell immunoreceptor with Ig and ITIM domains; V-set and immunoglobulin domain containing 9; V-set and immunoglobulin domain-containing protein 9; V-set and transmembrane domain containing 3; V-set and transmembrane domain-containing protein 3; Washington University cell adhesion molecule |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgctggtgtctcctcctgatctgggcccaggggctgaggcaggctcccctcgcctcaggaatgatgacaggcacaatagaaacaacggggaacatttctgcagagaaaggtggctctatcatcttacaatgtcacctctcctccaccacggcacaagtgacccaggtcaactgggagcagcaggaccagcttctggccatttgtaatgctgacttggggtggcacatctccccatccttcaaggatcgagtggccccaggtcccggcctgggcctcaccctccagtcgctgaccgtgaacgatacaggggagtacttctgcatctatcacacctaccctgatgggacgtacactgggagaatcttcctggaggtcctagaaagctcagtggctgagcacggtgccaggttccagattccattgcttggagccatggccgcgacgctggtggtcatctgcacagcagtcatcgtggtggtcgcgttgactagaaagaagaaagccctcagaatccattctgtggaaggtgacctcaggagaaaatcagctggacaggaggaatggagccccagtgctccctcacccccaggaagctgtgtccaggcagaagctgcacctgctgggctctgtggagagcagcggggagaggactgtgccgagctgcatgactacttcaatgtcctgagttacagaagcctgggtaactgcagcttcttcacagagactggttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribonucleotide reductase M2 B (TP53 inducible) - mitochondrial transcription termination factor - beaded filament structural protein 2, phakinin - cell division cycle 40 homolog (S. cerevisiae) |