Cart 1 Product Products 113,40 € (empty)
-
1 x JOSD1-Jose...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
RASSF2-Ras association (RalGDS/AF-6) domain family member 2 Gene
PTXBC117118
New product
Data sheet of RASSF2-Ras association (RalGDS/AF-6) domain family member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RASSF2-Ras association (RalGDS/AF-6) domain family member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117118 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RASSF2 |
| Origin species: | Human |
| Product name: | RASSF2-Ras association (RalGDS/AF-6) domain family member 2 Gene |
| Size: | 2ug |
| Accessions: | BC117118 |
| Gene id: | 9770 |
| Gene description: | Ras association (RalGDS/AF-6) domain family member 2 |
| Synonyms: | CENP-34; RASFADIN; ras association domain-containing protein 2; Ras association (RalGDS/AF-6) domain family 2; Ras association (RalGDS/AF-6) domain family member 2; centromere protein 34; Ras association domain family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactacagccaccaaacgtccctagtcccatgtggacaagataaatacatttccaaaaatgaacttctcttgcatctgaagacctacaacttgtactatgaaggccagaatttacagctccggcaccgggaggaagaagacgagttcattgtggaggggctcctgaacatctcctggggcctgcgccggcccattcgcctgcagatgcaggatgacaacgaacgcattcgaccccctccatcctcctcctcctggcactctggctgtaacctgggggctcagggaaccactctgaagcccctgactgtgcccaaagttcagatctcagaggtggatgccccgccggagggtgaccagatgccaagctccacagactccaggggcctgaagcccctgcaggaggacaccccacagctgatgcgcacacgcagtgatgttggggtgcgtcgccgtggcaatgtgaggacgcctagtgaccagcggcgaatcagacgccaccgcttctccatcaacggccatttctacaaccataagacatccgtgttcacaccagcctatggctctgtcaccaacgtccgcatcaacagcaccatgaccaccccacaggtcctgaagctgctgctcaacaaatttaagattgagaattcagcagaggagtttgccttgtacgtggtccatacgagtggtgagaaacagaagctgaaggccaccgattacccgctgattgcccgaatcctccagggcccatgtgagcagatctccaaagtgttcctaatggagaaggaccaggtggaggaagtcacctacgacgtggcccagtatataaagttcgagatgccggtacttaaaagcttcattcagaagctccaggaggaagaagatcgggaagtaaagaagctgatgcgcaagtacaccgtgctccggctaatgattcgacagaggctggaggagatagccgagaccccagcaacaatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - wingless-type MMTV integration site family, member 11 - alcohol dehydrogenase 1A (class I), alpha polypeptide - lengsin, lens protein with glutamine synthetase domain - potassium channel tetramerisation domain containing 3 |