Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RRP7A-ribosomal RNA processing 7 homolog A (S. cerevisiae) Gene
PTXBC073834
New product
Data sheet of RRP7A-ribosomal RNA processing 7 homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RRP7A-ribosomal RNA processing 7 homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC073834 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RRP7A |
| Origin species: | Human |
| Product name: | RRP7A-ribosomal RNA processing 7 homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC073834 |
| Gene id: | 27341 |
| Gene description: | ribosomal RNA processing 7 homolog A (S. cerevisiae) |
| Synonyms: | 1110014J01Rik; AA408146; Kheg1; ribosomal RNA-processing protein 7 homolog A; gastric cancer antigen Zg14 homolog; kidney highly expressed protein 1; ribosomal RNA processing 7 homolog A (S. cerevisiae) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggcgcgcaggaggaagtgcgccgcgcgggacccggaggaccgtatccccagcccactgggctacgcagctattccaatcaagttctctgaaaagcaacaggcttctcactacctctatgtgagagcacacggcgttcgacaaggcaccaagtccacctggcctcagaagaggactctttttgtcctcaatgtgcccccatactgcacagaggagagcctgtcccgcctcctgtccacctgtggcctcgtccagtctgtagagttgcaggagaagccggacctggctgagagcccaaaggagtcaaggtcgaagttttttcatcccaagccagttccgggtttccaggtagcctatgtggtgttccagaagccaagtggggtgtcagcggccttggccctgaagggccccctgctggtgtccacagagagccaccctgtgaagagtggcattcacaagtggatcagtgactacgcagactctgtgcccgaccctgaggccctgagggtggaagtggacacgttcatggaggcatatgaccagaagatcgctgaggaagaagctaaggccaaggaggaggagggggtccctgacgaggagggctgggtgaaggtgacccgccggggccggcggcctgtgctcccccggactgaggcagccagcttgcgggtgctggagagggagagacggaagcgcagccgaaaagagctgctcaacttctacgcctggcagcatcgagagagcaagatggagcatctagcgcagctgcgcaagaagttcgaggaggacaagcagaggatcgagctgctgcgggcccagcgcaaattccgaccgtactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chloride channel, calcium activated, family member 4 - mitogen-activated protein kinase binding protein 1 - chloride channel, calcium activated, family member 4 - ATP-binding cassette, sub-family G (WHITE), member 8 |