Cart 4 Product Products 837,05 € (empty)
-
1 x RAB3IL1-RA...121,50 € -
1 x LIX1-Lix1...121,50 € -
-
No products
To be determined Shipping
837,05 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 837,05 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 837,05 €
Data sheet of PRR10-proline rich 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRR10-proline rich 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113597 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRR10 |
| Origin species: | Human |
| Product name: | PRR10-proline rich 10 Gene |
| Size: | 2ug |
| Accessions: | BC113597 |
| Gene id: | 283165 |
| Gene description: | proline rich 10 |
| Synonyms: | PRR10; NCRNA00288; KIRREL3 antisense RNA 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaagcgcggagagtccctagacctcggagtgcgctgcaagaggggagaggagagagaccgccgcccctgctggaagccttcgcgtccgggggcggcgcgcgggggaaggggtctctggacagtcggtggaggcggcagccctacagagacagccgaaagccagcaacttggaaaaccgcccgaattctgggtttctgcacatccaggctggctccaggtctcttgtgcccaccgtgcaagccggcgggatgccagcaggtggcatcctctccagcgtttcttcgccaggcgtggagtccggaggccgaatccatcagtccccagccccctccccaagcctccggtgccaagtgctgggtcctgtgagcccctggccccgccccccacctccgccagcggggcgagccggagctgggtgacccagaccctcgcggaggcgggagcctacagaggatgccggccggccccaggttctgctgctggctggccaagaagtgacaggagggcaaggctcccccggaaagcgtccaagccctgctctcctgctcttccaagccttgctgcgtgttgcccccagggttttctgagatctgggacgaagagagtgatgtgcaaggttctgggtcccggtgcaggagtgaggggtacggctgtcgagtgctcggagcaggctggcgtttgggcacactgcagacctcagctcaccgccactttctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - forkhead box B1 - synaptogyrin 4 - forkhead box R1 - forkhead box P3 |