Cart 8 Product Products 1 535,41 € (empty)
-
1 x TPST1-tyro...121,50 € -
1 x PHF5A-PHD...113,40 € -
-
-
1 x Free Estriol399,00 € -
1 x SNRPE-smal...113,40 € -
1 x BUB3-buddi...121,50 € -
1 x ATXN7L3-at...121,50 €
No products
To be determined Shipping
1 535,41 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 535,41 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 535,41 €
View larger 
OR10W1-olfactory receptor, family 10, subfamily W, member 1 Gene
PTXBC132848
New product
Data sheet of OR10W1-olfactory receptor, family 10, subfamily W, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR10W1-olfactory receptor, family 10, subfamily W, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC132848 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR10W1 |
| Origin species: | Human |
| Product name: | OR10W1-olfactory receptor, family 10, subfamily W, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC132848 |
| Gene id: | 81341 |
| Gene description: | olfactory receptor, family 10, subfamily W, member 1 |
| Synonyms: | OR10W1P; OR10W1Q; OR11-236; UNQ6469; olfactory receptor 10W1; olfactory receptor OR11-236; olfactory receptor, family 10, subfamily W, member 1 pseudogene; olfactory receptor family 10 subfamily W member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaatttgtgttcctggcctatccctcctgcccagaactgcatattctgtccttccttggggtcagcctggtttatggtttgatcatcactgggaacattctcattgtggtgtccattcacacagaaacctgtctatgcacatccatgtactatttcctgggcagcctttctgggattgaaatatgctacactgcagtggtggtgccccatatcctggccaacaccctacagtcagagaagaccatcactctcctgggctgtgccacccagatggctttcttcattgcactgggcagtgctgattgcttcctcttggctgccatggcctatgaccgctatgtggccatttgccacccgttgcagtaccctctcctcatgacattgactctttgtgtccacttggttgtggcatcagtcatcagtggtctgttcctgtccttacaactggtggccttcatcttctctctgccattctgccaggctcagggcattgagcacttcttttgtgatgtgccaccagtcatgcatgttgtttgtgctcagagtcacattcatgagcagtcagtgctggtggcagccatactagccattgctgtgcctttcttcctcatcaccacctcctacaccttcatagtggctgctctgctcaagatccactcggctgctggccgccaccgggccttctccacctgctcttcccacctcactgtggtgctgctgcagtatggctgctgtgccttcatgtacctgtgccccagctccagctacaaccccaagcaagatcagttcatctcactggtgtacacattgggaaccccactgctcaacccacttatctatgccctgaggaacagtgagatgaaaggggccgtagggagagttcttaccaggaactgcctttcccagaacagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras association (RalGDS/AF-6) domain family member 2 - wingless-type MMTV integration site family, member 11 - alcohol dehydrogenase 1A (class I), alpha polypeptide - lengsin, lens protein with glutamine synthetase domain |