SOX14-SRY (sex determining region Y)-box 14 Gene

View larger

SOX14-SRY (sex determining region Y)-box 14 Gene

Reference: PTXBC106730

Condition: New product

Print

Data sheet of SOX14-SRY (sex determining region Y)-box 14 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about SOX14-SRY (sex determining region Y)-box 14 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC106730
Product type:	DNA & cDNA
Ncbi symbol:	SOX14
Origin species:	Human
Product name:	SOX14-SRY (sex determining region Y)-box 14 Gene
Size:	2ug
Accessions:	BC106730
Gene id:	8403
Gene description:	SRY (sex determining region Y)-box 14
Synonyms:	SOX28; transcription factor SOX-14; HMG box transcription factor SOX-14; SRY (sex determining region Y)-box 14; SRY-box 14
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtccaaaccttcagaccacatcaagcggcccatgaacgccttcatggtatggtcccggggccagcggcgcaagatggcccaggaaaaccccaagatgcacaactcggagatcagcaaacgcctaggtgccgaatggaagcttctgtccgaggcagagaagcggccatacatcgatgaagccaagcggctacgcgcccagcacatgaaggagcaccctgactacaagtaccgacctcggcgcaagcccaagaacctgctcaagaaggacaggtatgtcttccccttgccctacctgggcgacacggacccgctcaaggcggctggcctgcccgtgggggcctctgacggcctcctgagcgcgcccgagaaagcccgggccttcttgccgccggcctcggcgccctactccctgctggaccccgcgcagtttagctcgagcgccatccagaagatgggcgaagtgccccacaccttggctaccggcgctctgccctacgcgtccaccctgggctaccagaacggcgccttcggcagcctcagctgccccagccagcacacgcacacgcacccgtcccccaccaaccctggctacgtggtgccctgtaactgtaccgcctggtctgcctccaccctgcagccccccgtcgcctacatcctcttcccaggcatgaccaagactggcatagacccttattcgtcagcccacgctacggccatgtaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- coiled-coil domain containing 102B - keratin associated protein 10-11 - hereditary sensory neuropathy, type II - breast carcinoma amplified sequence 1

Reviews

Be the first to write your review !

Buy SOX14-SRY (sex determining region Y)-box 14 Gene now