C16orf54-chromosome 16 open reading frame 54 Gene View larger

C16orf54-chromosome 16 open reading frame 54 Gene

PTXBC104466

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf54-chromosome 16 open reading frame 54 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf54-chromosome 16 open reading frame 54 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC104466
Product type: DNA & cDNA
Ncbi symbol: C16orf54
Origin species: Human
Product name: C16orf54-chromosome 16 open reading frame 54 Gene
Size: 2ug
Accessions: BC104466
Gene id: 283897
Gene description: chromosome 16 open reading frame 54
Synonyms: transmembrane protein C16orf54; chromosome 16 open reading frame 54
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgttgactccagagccgccctctgggcgcgtggaggggccccccgcatgggaagcagccccatggccctcactgccctgtgggccctgcatccccatcatgctggtcctggccaccctggctgcgctcttcatcctcaccaccgctgtgttggctgaacgcctgttccgccgtgctctccgcccagaccccagccaccgtgcacccaccctggtgtggcgcccaggaggagagctgtggattgagcccatgggcaccgcccgagagcgctctgaggactggtatggctctgcggtccccctgctgacagatcgggcccctgagcctcccacccaggtgggcactttggaggcccgagcaacagccccacctgccccctcagccccaaattctgctcccagcaacttgggcccccagaccgtactggaggtcccagcccggagcaccttctgggggccccagccctgggaggggaggccccccgccacaggcctggtgagctgggctgaacccgagcagaggccagaggccagcgtccagtttgggagcccccaggccaggaggcagcggccagggagcccggatcctgagtggggcctccagccacgggtcaccttggagcagatctcagctttctggaagcgtgaaggccggaccagtgtggggttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 48
- chromosome 11 open reading frame 85
- chromosome 12 open reading frame 64
- chromosome 13 open reading frame 39

Reviews

Buy C16orf54-chromosome 16 open reading frame 54 Gene now

Add to cart