Cart 7 Product Products 822,27 € (empty)
-
1 x SUCLG2-suc...121,50 € -
1 x CUEDC2-CUE...113,40 € -
1 x AVL9-AVL9...121,50 € -
1 x CCDC51-coi...121,50 € -
-
1 x CDCA3-cell...121,50 € -
1 x FAM168A-fa...113,40 €
No products
To be determined Shipping
822,27 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 822,27 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 822,27 €
View larger 
SULT1A2-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 Gene
PTXBC113727
New product
Data sheet of SULT1A2-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SULT1A2-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113727 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SULT1A2 |
| Origin species: | Human |
| Product name: | SULT1A2-sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC113727 |
| Gene id: | 6799 |
| Gene description: | sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 |
| Synonyms: | HAST4; P-PST; ST1A2; STP2; TSPST2; sulfotransferase 1A2; P-PST 2; aryl sulfotransferase 2; arylamine sulfotransferase; phenol sulfotransferase 2; phenol-preferring phenol sulfotransferase2; phenol-sulfating phenol sulfotransferase 2; phenolic-metabolizing (P) form of PST; sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2; thermostable phenol sulfotransferase; sulfotransferase family 1A member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctgatccaggacatctctcgcccgccactggagtacgtgaagggggtcccgctcatcaagtactttgcagaggcactggggcccctgcagagcttccaggcccggcctgatgacctgctcatcagcacctaccccaagtccggcaccacctgggtgagccagattctggacatgatctaccagggcggtgacctggaaaagtgtcaccgagctcccatcttcatgcgggtgcccttccttgagttcaaagtcccagggattccctcagggatggagactctgaaaaacacaccagccccacgactcctgaagacacacctgcccctggctctgctcccccagactctgttggatcagaaggtcaaggtggtctatgttgcccgcaacgcaaaggatgtggcggtttcctactaccacttctaccacatggccaaagtgtaccctcaccctgggacctgggaaagcttcctggagaagttcatggctggagaagtgtcctatgggtcctggtaccagcacgtgcaagagtggtgggagctgagccgcacccaccctgttctctacctcttctatgaagacatgaaggagaaccccaaaagggagattcaaaagatcctggagtttgtggggcgctccctgccagaggagactgtggacctcatggttgagcacacgtcgttcaaggagatgaagaagaaccctatgaccaactacaccaccgtccgccgggagttcatggaccacagcatctcccccttcatgaggaaaggcatggctggggactggaagaccaccttcaccgtggcgcagaatgagcgcttcgatgcggactatgcggagaagatggcaggctgcagcctcagcttccgctctgagctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25 (mitochondrial carrier, brain), member 14 - zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2 - MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae) - zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1 |