Cart 6 Product Products 708,87 € (empty)
-
1 x SUCLG2-suc...121,50 € -
1 x CUEDC2-CUE...113,40 € -
1 x AVL9-AVL9...121,50 € -
1 x CCDC51-coi...121,50 € -
-
1 x CDCA3-cell...121,50 €
No products
To be determined Shipping
708,87 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 708,87 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 708,87 €
View larger 
Data sheet of CDR1-cerebellar degeneration-related protein 1, 34kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDR1-cerebellar degeneration-related protein 1, 34kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113472 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDR1 |
| Origin species: | Human |
| Product name: | CDR1-cerebellar degeneration-related protein 1, 34kDa Gene |
| Size: | 2ug |
| Accessions: | BC113472 |
| Gene id: | 1038 |
| Gene description: | cerebellar degeneration-related protein 1, 34kDa |
| Synonyms: | CDR; CDR34; CDR62A; cerebellar degeneration-related antigen 1; cerebellar degeneration-related protein 1, 34kDa; cerebellar degeneration related protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttggttggaagacgtggattttctggaagacgtacctttgttggaagacatacctttgttggaagacgtacctttgttggaagacgtacctttgttggaagacacaagtaggctggaagacattaatttgatggaagacatggctttgttggaagacgtggatttgctggaagacacggatttcctggaagacctggatttttcggaagctatggatttgagggaagacaaggattttctggaagacatggatagtctggaagacatggctttgttggaagacgtggacttgctggaagacacggatttcctggaagacccggattttttggaagctatagatttaagggaagacaaggattttctggaagacatggatagtctggaagacctggaggccattggaagatgtggattttctggaagacatggcttttttggaagacgtagattttcaggaagacccaaattatccggaagacttggattgttgggaagacgtggattttctggaagactgggaggttactggaagacatggattttctggaagacatggattttctggaagacgtggatcttcaggaagacatatattggctggaagacctggattttttccggaagatgtggattgactggaagacctggatttggtggaagacgtagatttttctggaagacactgactgactggaagacctggatttctttctggaagacactgattgactggaagacctggatttctttctggaagacactgattgactggaagatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 166, member A - CD79a molecule, immunoglobulin-associated alpha - tubulin tyrosine ligase-like family, member 10 - family with sequence similarity 187, member B |