Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C4orf49-chromosome 4 open reading frame 49 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C4orf49-chromosome 4 open reading frame 49 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104174 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C4orf49 |
| Origin species: | Human |
| Product name: | C4orf49-chromosome 4 open reading frame 49 Gene |
| Size: | 2ug |
| Accessions: | BC104174 |
| Gene id: | 84709 |
| Gene description: | chromosome 4 open reading frame 49 |
| Synonyms: | C4orf49; CESP-1; HUMMR; OSAP; protein MGARP; corneal endothelium-specific protein 1; hypoxia up-regulated mitochondrial movement regulator protein; ovary-specific acidic protein; mitochondria localized glutamic acid rich protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtatctccgcagggcggtctccaagactctggcgctgccgctgagggcgccccccaaccccgcgccgctcggaaaggacgcatctctgcgccggatgtcatctaacagattccctggatcatctggatcaaatatgatttattatctggttgtaggcgtcacagtcagtgctggtggatattatgcttacaagacagtcacatcagaccaagccaaacacacagaacataaaacaaatttgaaagaaaaaacaaaagcagagatacatccatttcaaggtgaaaaggagaatgttgcggaaactgagaaagcaagttcagaagccccagaagaacttatagtggaagctgaggtggtagatgctgaagaaagtcccagtgctacagttgtggtcataaaagaggcatctgcctgtccaggtcacgtggaggctgctccggagaccacagcagtcagtgctgaaaccgggccagaggtcacagatgcagcggcgagggaaaccacggaagtaaaccctgaaacaaccccagaggttacaaatgctgccctggatgaagctgtcaccatcgataatgataaagatacaacaaagaacgaaacctctgatgaatatgctgaactagaagaagaaaattctccagctgagtcagagtcctctgctggagatgatttacaggaggaagccagtgttggctctgaggctgcttcggctcaaggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nerve growth factor (beta polypeptide) - chromosome 6 open reading frame 25 - lymphocyte antigen 6 complex, locus K - chromosome 8 open reading frame 74 |