Cart 3 Product Products 340,20 € (empty)
-
1 x HIST1H3A-h...113,40 € -
1 x C9orf9-chr...113,40 € -
1 x SNRPN-smal...113,40 €
No products
To be determined Shipping
340,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,20 €
View larger 
LOC441251-Williams Beuren syndrome chromosome region 19 pseudogene Gene
PTXBC100974
New product
Data sheet of LOC441251-Williams Beuren syndrome chromosome region 19 pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC441251-Williams Beuren syndrome chromosome region 19 pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100974 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC441251 |
| Origin species: | Human |
| Product name: | LOC441251-Williams Beuren syndrome chromosome region 19 pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC100974 |
| Gene id: | 441251 |
| Gene description: | Williams Beuren syndrome chromosome region 19 pseudogene |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtggtgggacaaatctgaggagtcgttggaggaggagccacggaaggtgctcgcccctgagcctgaggagatctgggtggcggagatgctgtgtggcctcaagatgaagctgaagcgacggcgagtgtcgctcgtgctccctgagcaccacgaggccttcaacaggctgcttgaggatcctgtcattaaaagattcctggcctgggacaaaggtctgagggtgtcggacaagtatctcctggctatggtcatagtgtatttcagccgggccggcctcccctcctggcaataccaatgcattcatttcttcctggctctctacctggccaatgacatggaggaggacgacgaggaccccaaacaaaacatcttctacttcctgtatgggaagacccgctctcgcatacccttgctccgtaagcgtcggttccagttatgccgttgcatgaacccgagggccaggaagaaccgctctcagatagtcctgttccagaaacttcggttccagttcttctgttccatgagctgcagggcttgggtttccccggaggagttggaggagatccaggcttatgacccagagcactgggtgtgggcgcgagatcgcgctcgcctttcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium inwardly-rectifying channel, subfamily J, member 4 - protein phosphatase 1, regulatory (inhibitor) subunit 12A - RAS guanyl releasing protein 1 (calcium and DAG-regulated) - phospholipase A2, group IVA (cytosolic, calcium-dependent) |