Cart 10 Product Products 1 573,62 € (empty)
-
1 x BRI3-brain...113,40 € -
1 x SMRTe...259,07 € -
1 x TMEM66-tra...121,50 € -
1 x HAPLN1-hya...121,50 € -
1 x FGF1-fibro...113,40 € -
1 x PGF-placen...113,40 € -
1 x RCHY1-ring...113,40 € -
-
-
1 x Estrone...399,00 €
No products
To be determined Shipping
1 573,62 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 573,62 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 573,62 €
Data sheet of CRYGD-crystallin, gamma D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRYGD-crystallin, gamma D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117338 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRYGD |
| Origin species: | Human |
| Product name: | CRYGD-crystallin, gamma D Gene |
| Size: | 2ug |
| Accessions: | BC117338 |
| Gene id: | 1421 |
| Gene description: | crystallin, gamma D |
| Synonyms: | CACA; CCA3; CCP; CRYG4; CTRCT4; PCC; cry-g-D; gamma-crystallin D; gamma crystallin 4; gamma-D-crystallin; crystallin gamma D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaagatcaccctctacgaggaccggggcttccagggccgccactacgaatgcagcagcgaccaccccaacctgcagccctacttgagccgctgcaactcggcgcgcgtggacagcggctgctggatgctctatgagcagcccaactactcgggcctccagtacttcctgcgccgcggcgactatgccgaccaccagcagtggatgggcctcagcgactcggtccgctcctgccgcctcatcccccactctggctctcacaggatcagactctatgagagggaggactacagaggccagatgatagagttcactgaggactgctcctgtcttcaggaccgcttccgcttcaatgaaatccactccctcaacgtgctggagggctcctgggtcctctacgagctgtccaactaccgaggacggcagtacctgctgatgccaggggactataggcgctaccaggactggggggccacgaatgccagagtgggctctctgaggagagtcatagatttctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - elastase 2B - H6 family homeobox 2 - syntrophin, gamma 2 - apolipoprotein L, 1 |