Cart 7 Product Products 804,71 € (empty)
-
-
1 x IL28A-inte...113,40 € -
-
1 x ORC6L-orig...113,40 € -
1 x ARMCX3-arm...121,50 € -
1 x RRP15-ribo...113,40 € -
1 x RBMS3-RNA...121,50 €
No products
To be determined Shipping
804,71 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 804,71 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 804,71 €
View larger 
RASSF3-Ras association (RalGDS/AF-6) domain family member 3 Gene
PTXBC100952
New product
Data sheet of RASSF3-Ras association (RalGDS/AF-6) domain family member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RASSF3-Ras association (RalGDS/AF-6) domain family member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100952 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RASSF3 |
| Origin species: | Human |
| Product name: | RASSF3-Ras association (RalGDS/AF-6) domain family member 3 Gene |
| Size: | 2ug |
| Accessions: | BC100952 |
| Gene id: | 283349 |
| Gene description: | Ras association (RalGDS/AF-6) domain family member 3 |
| Synonyms: | RASSF5; ras association domain-containing protein 3; Ras association (RalGDS/AF-6) domain family 3; Ras association (RalGDS/AF-6) domain family member 3; Ras association domain family member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccttgaattcaaatgggatttacactggcttcattaaagtacagatggaactctgcaaacctccacagacttctccaaattctggaaaactctctcccagtagcaatggctgtatgaatacacttcatatcagcagcacaaacactgtcggggaagtgatcgaggccctgctcaaaaagtttctcgtgactgagagccctgccaagtttgcactttataagcgttgtcacagggaagaccaagtctacgcctgcaagctctcagaccgggaacatccactctacctgcgtttggtagcagggcccagaacagacacacttagttttgttcttcgtgaacatgaaattggagagtgggaagccttcagccttccagaactacagaatttcttgcgcatcttggacaaggaagaagatgaacagctgcagaacctgaagaggcgctacacagcctacaggcagaagctggaagaagccctccgtgaggtgtggaagcctgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor, family 10, subfamily W, member 1 - Ras association (RalGDS/AF-6) domain family member 2 - wingless-type MMTV integration site family, member 11 - alcohol dehydrogenase 1A (class I), alpha polypeptide |