Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of KRTAP10-3-keratin associated protein 10-3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP10-3-keratin associated protein 10-3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC133677 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP10-3 |
| Origin species: | Human |
| Product name: | KRTAP10-3-keratin associated protein 10-3 Gene |
| Size: | 2ug |
| Accessions: | BC133677 |
| Gene id: | 386682 |
| Gene description: | keratin associated protein 10-3 |
| Synonyms: | KAP10.3; KAP18-3; KAP18.3; KRTAP10.3; KRTAP18-3; KRTAP18.3; keratin-associated protein 10-3; high sulfur keratin-associated protein 10.3; keratin-associated protein 18-3; keratin-associated protein 18.3; keratin associated protein 10-3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgcgtccaccatgtccgtctgctccagcgcttactctgactcctggcaggtggacgcctgcccagagagctgctgtgagcccccctgctgtgcccccagctgctgcgccctggccccctgcctgaccctggtctgcaccccagtgagctgtgtgtccagcccctgctgccaggcggcctgtgagcccagcccctgccagtcaggctgcaccagctcctgcacgccctcgtgctgccagcagtctagctgccagccagcttgctgcacatcctccccctgccagcaggcctgctgcgtgcctgtctgctgcaagccagtctgctgtgtgcccgtctgctgcaagcctgtctgctgcaagcccatctgctgtgtgcccgtctgctctggggcttcctcttcatgctgccagcagtctagccgccagccggcttgctgcaccacctcctgctgcagaccctcctcctccgtgtccctcctctgccgcccggcctcctgcgtgtccctcctctgccgccccacgtgctcccgcctctcttccgcgtgctgcggcctctcctcaggccagaagtccagctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lipoma HMGIC fusion partner-like 4 - RAB40A, member RAS oncogene family - RAB11B, member RAS oncogene family - programmed cell death 1 ligand 2 |