CTAG1A-cancer/testis antigen 1A Gene View larger

CTAG1A-cancer/testis antigen 1A Gene

PTXBC130362

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTAG1A-cancer/testis antigen 1A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTAG1A-cancer/testis antigen 1A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC130362
Product type: DNA & cDNA
Ncbi symbol: CTAG1A
Origin species: Human
Product name: CTAG1A-cancer/testis antigen 1A Gene
Size: 2ug
Accessions: BC130362
Gene id: 246100
Gene description: cancer/testis antigen 1A
Synonyms: CT6.1; ESO1; LAGE-2; LAGE2A; NY-ESO-1; cancer/testis antigen 1; New York Esophageal Squamous Cell Carcinoma 1; autoimmunogenic cancer/testis antigen NY-ESO-1; cancer/testis antigen 1-A; cancer/testis antigen 6.1; l antigen family member 2; cancer/testis antigen 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggccgaaggccggggcacagggggttcgacgggcgatgctgatggcccaggaggccctggcattcctgatggcccagggggcaatgctggcggcccaggagaggcgggtgccacgggcggcagaggtccccggggcgcaggggcagcaagggcctcggggccgggaggaggcgccccgcggggtccgcatggcggcgcggcttcagggctgaatggatgctgcagatgcggggccagggggccggagagccgcctgcttgagttctacctcgccatgcctttcgcgacacccatggaagcagagctggcccgcaggagcctggcccaggatgccccaccgcttcccgtgccaggggtgcttctgaaggagttcactgtgtccggcaacatactgactatccgactgactgctgcagaccaccgccaactgcagctctccatcagctcctgtctccagcagctttccctgttgatgtggatcacgcagtgctttctgcccgtgtttttggctcagcctccctcagggcagaggcgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC148231
- transmembrane protein 69
- transmembrane protein 56
- cyclin I family, member 2

Reviews

Buy CTAG1A-cancer/testis antigen 1A Gene now

Add to cart