Cart 44 Product Products 5 998,96 € (empty)
-
-
1 x TGFB1-tran...121,50 € -
-
1 x TRAF4...259,07 € -
-
1 x MRPL36-mit...113,40 € -
-
1 x COX7A2L-cy...113,40 € -
1 x FAM83F-fam...121,50 € -
1 x PTDSS2-pho...121,50 € -
1 x STH-saitoh...113,40 € -
1 x OMG-oligod...121,50 € -
1 x Ret...259,07 € -
1 x C2orf53-ch...121,50 € -
1 x CD320-CD32...121,50 € -
-
1 x C15orf23-c...121,50 € -
1 x ATP1B1-ATP...121,50 € -
1 x JMJD7-jumo...121,50 € -
1 x LHR...259,07 € -
-
-
-
1 x FAM122B-fa...113,40 € -
1 x RUVBL2-Ruv...113,40 € -
1 x C6orf123-c...113,40 € -
1 x C19orf39-c...113,40 € -
1 x CAPZB-capp...121,50 € -
-
1 x TMEM126B-t...113,40 € -
1 x TULP1-tubb...121,50 € -
1 x NCALD-neur...113,40 € -
1 x TANK-TRAF...121,50 € -
-
1 x SLC25A11-s...121,50 € -
1 x CCDC50-coi...121,50 € -
1 x ADIPOQ-adi...113,40 € -
-
1 x ASNA1-arsA...121,50 € -
1 x KLHDC4-kel...121,50 € -
1 x KIAA1486-K...113,40 € -
-
1 x CST8-cysta...113,40 € -
1 x LONRF1-LON...121,50 €
No products
To be determined Shipping
5 998,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 44 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 998,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 998,96 €
View larger 
Data sheet of ROPN1-ropporin, rhophilin associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ROPN1-ropporin, rhophilin associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC132744 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ROPN1 |
| Origin species: | Human |
| Product name: | ROPN1-ropporin, rhophilin associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC132744 |
| Gene id: | 54763 |
| Gene description: | ropporin, rhophilin associated protein 1 |
| Synonyms: | CT91; ODF6; RHPNAP1; ROPN1A; ropporin; ropporin-1A; cancer/testis antigen 91; outer dense fiber of sperm tails 6; rhophilin-associated protein 1A; ropporin, rhophilin associated protein 1; testis secretory sperm-binding protein Li 239w; rhophilin associated tail protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcagacagataagccaacatgcatcccgccggagctgccgaagatgctgaaggagtttgccaaagccgccattagggtgcagccgcaggacctcatccagtgggcagccgattattttgaggccctgtcccgtggagagacgcctccggtgagagagcggtctgagcgagtcgctttgtgtaaccgggcagagctaacacctgagctgttaaagatcctgcattctcaggttgctggcagactgatcatccgtgcagaggagctggcccagatgtggaaagtggtgaatctcccaacagatctgtttaatagtgtgatgaatgtgggtcgcttcacggaggagatcgagtggctgaagtttttagcccttgcttgcagcgctctgggagttactattaccaaaactctcaagatagtgtgtgaggtcttatcatgtgaccataatggtgggtcgccccggatcccgttcagcaccttccagtttctctacacgtatattgccaaagtggatggggagatctctgcatcacatgtcagcaggatgctaaactacatggaacaggaagtaattggccctgatggtataatcacagtgaatgactttacccaaaaccccagggttcagctggagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C-type lectin domain family 3, member A - chromosome 20 open reading frame 118 - transcription factor Dp family, member 3 - hydroxyacid oxidase (glycolate oxidase) 1 |